Incidental Mutation 'R3902:Plekhn1'
ID309225
Institutional Source Beutler Lab
Gene Symbol Plekhn1
Ensembl Gene ENSMUSG00000078485
Gene Namepleckstrin homology domain containing, family N member 1
Synonyms
MMRRC Submission 040811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3902 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location156221456-156234857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156225669 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 63 (I63F)
Ref Sequence ENSEMBL: ENSMUSP00000151311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105569] [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105569
SMART Domains Protein: ENSMUSP00000101194
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
low complexity region 20 50 N/A INTRINSIC
BTB 90 187 3.55e-30 SMART
BACK 192 294 1.08e-42 SMART
Kelch 341 387 4.01e-8 SMART
Kelch 388 434 5.41e-14 SMART
Kelch 435 481 6.97e-17 SMART
Kelch 482 528 1.55e-14 SMART
Kelch 529 575 2.02e-13 SMART
Kelch 576 622 1.34e-9 SMART
low complexity region 626 640 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105571
AA Change: I63F

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485
AA Change: I63F

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184043
Predicted Effect possibly damaging
Transcript: ENSMUST00000217885
AA Change: I63F

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218699
AA Change: I63F

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Eif2b3 C T 4: 117,022,207 R15W probably damaging Het
Eprs G A 1: 185,379,742 probably null Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbxl20 T A 11: 98,097,035 T61S probably benign Het
Fry A G 5: 150,345,927 E211G probably damaging Het
Gatd1 A G 7: 141,409,101 L215P probably damaging Het
Gm14698 A G X: 68,821,647 M101V probably benign Het
Gm15922 G A 7: 3,737,277 T315I probably damaging Het
Gys2 A G 6: 142,472,800 M1T probably null Het
Hacd4 A C 4: 88,437,501 I49R probably damaging Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Klhl26 T C 8: 70,452,366 D217G probably damaging Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Mettl21a C T 1: 64,608,081 V106I probably benign Het
Mpdz A G 4: 81,307,116 V1427A probably damaging Het
Mug2 A T 6: 122,075,567 D1024V probably damaging Het
Myl7 T A 11: 5,898,430 K38M probably damaging Het
Myl7 T G 11: 5,898,431 K38Q probably damaging Het
Myom2 T C 8: 15,104,165 V701A probably benign Het
Nipbl A G 15: 8,350,246 S1021P possibly damaging Het
Optc A G 1: 133,897,963 M275T probably benign Het
Pclo A T 5: 14,712,522 T385S probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Rassf1 A G 9: 107,554,840 Y21C probably damaging Het
Slc12a1 A T 2: 125,188,193 I562F probably damaging Het
Slc16a6 A G 11: 109,458,561 S141P probably damaging Het
Sntn T C 14: 13,679,084 L86P probably damaging Het
Taar4 T A 10: 23,961,015 N174K probably damaging Het
Trav12-3 G T 14: 53,622,029 C44F probably damaging Het
Triml2 A G 8: 43,190,360 R240G probably benign Het
Vmn1r3 A G 4: 3,185,241 M22T probably benign Het
Vmn2r7 C A 3: 64,719,516 Q26H possibly damaging Het
Vmn2r72 T C 7: 85,749,735 D470G possibly damaging Het
Xpo6 A G 7: 126,120,409 Y602H probably damaging Het
Zfp287 T C 11: 62,712,202 T241A probably benign Het
Zfp386 A G 12: 116,060,155 K498E probably damaging Het
Zzef1 T C 11: 72,908,500 L2392P probably damaging Het
Other mutations in Plekhn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL00473:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL02104:Plekhn1 APN 4 156222408 missense probably benign 0.25
IGL02122:Plekhn1 APN 4 156223856 critical splice donor site probably null
IGL02210:Plekhn1 APN 4 156223649 missense probably damaging 1.00
PIT4142001:Plekhn1 UTSW 4 156224940 nonsense probably null
PIT4366001:Plekhn1 UTSW 4 156224811 missense probably damaging 0.99
R0123:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0134:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0225:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0276:Plekhn1 UTSW 4 156228246 missense probably damaging 0.99
R0282:Plekhn1 UTSW 4 156228323 splice site probably benign
R0540:Plekhn1 UTSW 4 156222747 missense possibly damaging 0.87
R0569:Plekhn1 UTSW 4 156225201 missense probably damaging 1.00
R0656:Plekhn1 UTSW 4 156225364 missense possibly damaging 0.55
R0798:Plekhn1 UTSW 4 156228263 missense probably damaging 0.96
R0848:Plekhn1 UTSW 4 156223564 critical splice donor site probably null
R1803:Plekhn1 UTSW 4 156222381 missense probably benign 0.20
R2168:Plekhn1 UTSW 4 156221882 missense probably damaging 0.99
R2356:Plekhn1 UTSW 4 156222701 missense probably damaging 1.00
R2516:Plekhn1 UTSW 4 156222659 missense probably damaging 1.00
R3746:Plekhn1 UTSW 4 156225594 missense probably benign 0.00
R3818:Plekhn1 UTSW 4 156225533 missense probably damaging 1.00
R4024:Plekhn1 UTSW 4 156224750 missense probably damaging 1.00
R4057:Plekhn1 UTSW 4 156224693 unclassified probably null
R4176:Plekhn1 UTSW 4 156221801 missense probably benign 0.02
R4402:Plekhn1 UTSW 4 156225356 missense probably damaging 1.00
R4405:Plekhn1 UTSW 4 156225273 splice site probably null
R4477:Plekhn1 UTSW 4 156223399 missense probably damaging 1.00
R4515:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4517:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4518:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R5086:Plekhn1 UTSW 4 156222424 missense probably benign 0.00
R5092:Plekhn1 UTSW 4 156224765 missense possibly damaging 0.93
R5201:Plekhn1 UTSW 4 156230527 missense probably benign 0.00
R5896:Plekhn1 UTSW 4 156223874 missense probably benign 0.02
R5913:Plekhn1 UTSW 4 156222695 missense probably damaging 1.00
R6124:Plekhn1 UTSW 4 156225239 missense possibly damaging 0.87
R6244:Plekhn1 UTSW 4 156230558 synonymous probably null
R6263:Plekhn1 UTSW 4 156225193 critical splice donor site probably null
R6430:Plekhn1 UTSW 4 156221804 missense probably benign 0.00
R6703:Plekhn1 UTSW 4 156224793 missense probably benign 0.00
R6723:Plekhn1 UTSW 4 156224569 missense probably damaging 1.00
R6741:Plekhn1 UTSW 4 156221792 missense probably damaging 0.98
R7057:Plekhn1 UTSW 4 156233917 missense probably damaging 0.99
R7135:Plekhn1 UTSW 4 156223335 missense probably benign 0.04
R7347:Plekhn1 UTSW 4 156222671 missense probably benign 0.00
R7408:Plekhn1 UTSW 4 156233961 missense probably benign 0.14
R7423:Plekhn1 UTSW 4 156230685 missense probably benign 0.15
R7500:Plekhn1 UTSW 4 156233314 missense probably benign 0.19
R7613:Plekhn1 UTSW 4 156224820 missense probably benign 0.00
R7626:Plekhn1 UTSW 4 156225653 missense probably benign 0.00
R7738:Plekhn1 UTSW 4 156232234 missense probably damaging 1.00
X0023:Plekhn1 UTSW 4 156222354 missense possibly damaging 0.76
X0065:Plekhn1 UTSW 4 156224915 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCACGTATTTGCCGACTTG -3'
(R):5'- TAAGTTTATACCATAGAGCGCAGAG -3'

Sequencing Primer
(F):5'- ACTTGGCGTGGCTCCTAC -3'
(R):5'- TATTCCACTTTTTATGTGACGAGGC -3'
Posted On2015-04-17