Mutagenetix > Incidental Mutations

Incidental Mutation 'R3902:Kmt2e'

309227

Institutional Source

Beutler Lab

Gene Symbol

Kmt2e

Ensembl Gene

ENSMUSG00000029004

Gene Name

lysine (K)-specific methyltransferase 2E

Synonyms

D230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5

MMRRC Submission

040811-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3902 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23434441-23504235 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23501642 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1401 (N1401S)

Ref Sequence

ENSEMBL: ENSMUSP00000110781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088392] [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000126586] [ENSMUST00000196260] [ENSMUST00000196929]

Predicted Effect

probably benign
Transcript: ENSMUST00000088392

SMART Domains

Protein: ENSMUSP00000085734
Gene: ENSMUSG00000062604

Domain	Start	End	E-Value	Type
low complexity region	5	46	N/A	INTRINSIC
Pfam:Pkinase	79	228	1.3e-22	PFAM
Pfam:Pkinase_Tyr	79	228	1e-9	PFAM
coiled coil region	263	314	N/A	INTRINSIC
coiled coil region	339	373	N/A	INTRINSIC
low complexity region	393	406	N/A	INTRINSIC
Pfam:Pkinase	506	680	1.9e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000094962
AA Change: N1401S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: N1401S

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000115128
AA Change: N1401S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: N1401S

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000126586

Predicted Effect

probably benign
Transcript: ENSMUST00000194010

Predicted Effect

probably benign
Transcript: ENSMUST00000196260

SMART Domains

Protein: ENSMUSP00000143791
Gene: ENSMUSG00000029004

Domain	Start	End	E-Value	Type
low complexity region	49	62	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196929

SMART Domains

Protein: ENSMUSP00000143216
Gene: ENSMUSG00000062604

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	1	131	2.6e-8	PFAM
Pfam:Pkinase	2	130	2.3e-18	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atmin	A	G	8: 116,956,297	N232S	probably benign	Het
Brat1	A	C	5: 140,717,996	D668A	possibly damaging	Het
Eif2b3	C	T	4: 117,022,207	R15W	probably damaging	Het
Eprs	G	A	1: 185,379,742		probably null	Het
F5	A	G	1: 164,176,229	T198A	probably benign	Het
Fbxl20	T	A	11: 98,097,035	T61S	probably benign	Het
Fry	A	G	5: 150,345,927	E211G	probably damaging	Het
Gatd1	A	G	7: 141,409,101	L215P	probably damaging	Het
Gm14698	A	G	X: 68,821,647	M101V	probably benign	Het
Gm15922	G	A	7: 3,737,277	T315I	probably damaging	Het
Gys2	A	G	6: 142,472,800	M1T	probably null	Het
Hacd4	A	C	4: 88,437,501	I49R	probably damaging	Het
Jph3	G	T	8: 121,753,419	D279Y	possibly damaging	Het
Klhl26	T	C	8: 70,452,366	D217G	probably damaging	Het
Mettl21a	C	T	1: 64,608,081	V106I	probably benign	Het
Mpdz	A	G	4: 81,307,116	V1427A	probably damaging	Het
Mug2	A	T	6: 122,075,567	D1024V	probably damaging	Het
Myl7	T	A	11: 5,898,430	K38M	probably damaging	Het
Myl7	T	G	11: 5,898,431	K38Q	probably damaging	Het
Myom2	T	C	8: 15,104,165	V701A	probably benign	Het
Nipbl	A	G	15: 8,350,246	S1021P	possibly damaging	Het
Optc	A	G	1: 133,897,963	M275T	probably benign	Het
Pclo	A	T	5: 14,712,522	T385S	probably benign	Het
Pdgfra	T	A	5: 75,192,508	N986K	probably benign	Het
Plekhn1	T	A	4: 156,225,669	I63F	possibly damaging	Het
Pogk	C	T	1: 166,403,624	V45I	probably damaging	Het
Rassf1	A	G	9: 107,554,840	Y21C	probably damaging	Het
Slc12a1	A	T	2: 125,188,193	I562F	probably damaging	Het
Slc16a6	A	G	11: 109,458,561	S141P	probably damaging	Het
Sntn	T	C	14: 13,679,084	L86P	probably damaging	Het
Taar4	T	A	10: 23,961,015	N174K	probably damaging	Het
Trav12-3	G	T	14: 53,622,029	C44F	probably damaging	Het
Triml2	A	G	8: 43,190,360	R240G	probably benign	Het
Vmn1r3	A	G	4: 3,185,241	M22T	probably benign	Het
Vmn2r7	C	A	3: 64,719,516	Q26H	possibly damaging	Het
Vmn2r72	T	C	7: 85,749,735	D470G	possibly damaging	Het
Xpo6	A	G	7: 126,120,409	Y602H	probably damaging	Het
Zfp287	T	C	11: 62,712,202	T241A	probably benign	Het
Zfp386	A	G	12: 116,060,155	K498E	probably damaging	Het
Zzef1	T	C	11: 72,908,500	L2392P	probably damaging	Het

Other mutations in Kmt2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Kmt2e	APN	5	23492358	missense	probably damaging	0.99
IGL01330:Kmt2e	APN	5	23497948	missense	possibly damaging	0.95
IGL01457:Kmt2e	APN	5	23502019	missense	possibly damaging	0.62
IGL01691:Kmt2e	APN	5	23497091	missense	probably benign
IGL02274:Kmt2e	APN	5	23500760	missense	probably benign	0.00
IGL02934:Kmt2e	APN	5	23497884	missense	probably damaging	0.97
IGL02964:Kmt2e	APN	5	23467100	splice site	probably benign
IGL03011:Kmt2e	APN	5	23497542	missense	probably damaging	1.00
IGL03291:Kmt2e	APN	5	23499291	missense	probably damaging	1.00
R0035:Kmt2e	UTSW	5	23485621	splice site	probably benign
R0446:Kmt2e	UTSW	5	23497534	splice site	probably null
R0498:Kmt2e	UTSW	5	23478972	nonsense	probably null
R0699:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0701:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0761:Kmt2e	UTSW	5	23503034	nonsense	probably null
R1110:Kmt2e	UTSW	5	23502655	missense	probably damaging	1.00
R1295:Kmt2e	UTSW	5	23502404	missense	probably damaging	0.99
R1432:Kmt2e	UTSW	5	23450321	missense	probably benign	0.39
R1495:Kmt2e	UTSW	5	23499327	missense	possibly damaging	0.83
R1505:Kmt2e	UTSW	5	23500535	missense	probably null	0.01
R1623:Kmt2e	UTSW	5	23482502	missense	probably damaging	1.00
R1675:Kmt2e	UTSW	5	23482453	nonsense	probably null
R1691:Kmt2e	UTSW	5	23464849	missense	probably damaging	1.00
R1778:Kmt2e	UTSW	5	23492364	missense	probably damaging	1.00
R1820:Kmt2e	UTSW	5	23473547	missense	probably damaging	1.00
R1846:Kmt2e	UTSW	5	23499486	intron	probably benign
R1912:Kmt2e	UTSW	5	23492395	missense	probably benign	0.07
R2070:Kmt2e	UTSW	5	23501995	missense	probably benign
R2195:Kmt2e	UTSW	5	23502196	splice site	probably null
R2571:Kmt2e	UTSW	5	23501887	missense	probably benign	0.08
R3901:Kmt2e	UTSW	5	23501642	missense	probably benign	0.02
R3905:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3906:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3909:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3956:Kmt2e	UTSW	5	23496025	missense	probably benign	0.00
R4242:Kmt2e	UTSW	5	23502822	unclassified	probably benign
R4299:Kmt2e	UTSW	5	23464914	missense	probably damaging	1.00
R4448:Kmt2e	UTSW	5	23464790	missense	possibly damaging	0.80
R4528:Kmt2e	UTSW	5	23473558	missense	possibly damaging	0.69
R4574:Kmt2e	UTSW	5	23492407	missense	possibly damaging	0.60
R4719:Kmt2e	UTSW	5	23492315	missense	probably damaging	1.00
R4754:Kmt2e	UTSW	5	23482441	missense	possibly damaging	0.88
R4787:Kmt2e	UTSW	5	23463083	missense	possibly damaging	0.65
R4812:Kmt2e	UTSW	5	23502587	missense	possibly damaging	0.86
R4853:Kmt2e	UTSW	5	23502341	missense	probably damaging	1.00
R5138:Kmt2e	UTSW	5	23502695	missense	probably damaging	0.99
R5306:Kmt2e	UTSW	5	23499333	missense	probably damaging	0.98
R5659:Kmt2e	UTSW	5	23497807	missense	probably damaging	0.99
R5907:Kmt2e	UTSW	5	23464706	missense	probably damaging	1.00
R5920:Kmt2e	UTSW	5	23499442	missense	possibly damaging	0.50
R6280:Kmt2e	UTSW	5	23499516	missense	possibly damaging	0.48
R6353:Kmt2e	UTSW	5	23493245	missense	probably damaging	1.00
R6375:Kmt2e	UTSW	5	23499519	missense	probably benign
R6553:Kmt2e	UTSW	5	23463026	missense	probably damaging	0.99
R6572:Kmt2e	UTSW	5	23497581	missense	possibly damaging	0.66
R6678:Kmt2e	UTSW	5	23499295	missense	possibly damaging	0.54
R6791:Kmt2e	UTSW	5	23499476	intron	probably benign
R6792:Kmt2e	UTSW	5	23499476	intron	probably benign
R6794:Kmt2e	UTSW	5	23499476	intron	probably benign
R6797:Kmt2e	UTSW	5	23482507	missense	possibly damaging	0.82
R6947:Kmt2e	UTSW	5	23497545	missense	probably damaging	1.00
R7023:Kmt2e	UTSW	5	23500487	missense	possibly damaging	0.46
R7036:Kmt2e	UTSW	5	23478743	missense	probably null	1.00
R7173:Kmt2e	UTSW	5	23464857	missense	probably damaging	1.00
R7202:Kmt2e	UTSW	5	23492294	unclassified	probably benign
R7563:Kmt2e	UTSW	5	23500273	missense	probably damaging	1.00
R7571:Kmt2e	UTSW	5	23478587	missense	probably damaging	1.00
R7604:Kmt2e	UTSW	5	23501765	missense	not run
R7722:Kmt2e	UTSW	5	23497018	missense	probably benign	0.00
R7758:Kmt2e	UTSW	5	23496070	missense	possibly damaging	0.92
R7794:Kmt2e	UTSW	5	23464716	missense	probably damaging	1.00
R8137:Kmt2e	UTSW	5	23501954	missense	probably damaging	1.00
R8341:Kmt2e	UTSW	5	23499453	missense	probably damaging	0.98
R8383:Kmt2e	UTSW	5	23485541	missense	probably benign	0.08
R8400:Kmt2e	UTSW	5	23497092	missense	probably benign	0.17
R8546:Kmt2e	UTSW	5	23481244	missense	probably damaging	1.00
R8750:Kmt2e	UTSW	5	23493217	missense	probably benign
RF026:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF028:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF040:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF042:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
Z1177:Kmt2e	UTSW	5	23481208	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAACTCACCGTTGTCGTCC -3'
(R):5'- GAGAGGTAACCATGCTGCAC -3'

Sequencing Primer
(F):5'- ACCGTTGTCGTCCTCACACTG -3'
(R):5'- TAACCATGCTGCACGGGGG -3'

Posted On

2015-04-17