Incidental Mutation 'R3902:Klhl26'
ID309239
Institutional Source Beutler Lab
Gene Symbol Klhl26
Ensembl Gene ENSMUSG00000055707
Gene Namekelch-like 26
Synonyms
MMRRC Submission 040811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3902 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70450219-70476968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70452366 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 217 (D217G)
Ref Sequence ENSEMBL: ENSMUSP00000147349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066597] [ENSMUST00000166976] [ENSMUST00000209415] [ENSMUST00000209567] [ENSMUST00000210250]
Predicted Effect probably damaging
Transcript: ENSMUST00000066597
AA Change: D298G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069077
Gene: ENSMUSG00000055707
AA Change: D298G

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
BTB 54 151 1.56e-26 SMART
BACK 156 257 1.62e-28 SMART
Blast:Kelch 301 352 4e-27 BLAST
Kelch 353 404 1.44e0 SMART
Kelch 405 451 2.86e-4 SMART
Kelch 452 499 1.21e-2 SMART
Kelch 500 550 4.27e-3 SMART
Kelch 551 597 4.93e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166976
AA Change: D237G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129607
Gene: ENSMUSG00000055707
AA Change: D237G

DomainStartEndE-ValueType
Pfam:BTB 19 89 1.7e-13 PFAM
BACK 95 196 1.62e-28 SMART
Blast:Kelch 240 291 4e-27 BLAST
Kelch 292 343 1.44e0 SMART
Kelch 344 390 2.86e-4 SMART
Kelch 391 438 1.21e-2 SMART
Kelch 439 489 4.27e-3 SMART
Kelch 490 536 4.93e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209415
Predicted Effect probably damaging
Transcript: ENSMUST00000209567
AA Change: D217G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000210250
AA Change: D264G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Eif2b3 C T 4: 117,022,207 R15W probably damaging Het
Eprs G A 1: 185,379,742 probably null Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbxl20 T A 11: 98,097,035 T61S probably benign Het
Fry A G 5: 150,345,927 E211G probably damaging Het
Gatd1 A G 7: 141,409,101 L215P probably damaging Het
Gm14698 A G X: 68,821,647 M101V probably benign Het
Gm15922 G A 7: 3,737,277 T315I probably damaging Het
Gys2 A G 6: 142,472,800 M1T probably null Het
Hacd4 A C 4: 88,437,501 I49R probably damaging Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Mettl21a C T 1: 64,608,081 V106I probably benign Het
Mpdz A G 4: 81,307,116 V1427A probably damaging Het
Mug2 A T 6: 122,075,567 D1024V probably damaging Het
Myl7 T A 11: 5,898,430 K38M probably damaging Het
Myl7 T G 11: 5,898,431 K38Q probably damaging Het
Myom2 T C 8: 15,104,165 V701A probably benign Het
Nipbl A G 15: 8,350,246 S1021P possibly damaging Het
Optc A G 1: 133,897,963 M275T probably benign Het
Pclo A T 5: 14,712,522 T385S probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Plekhn1 T A 4: 156,225,669 I63F possibly damaging Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Rassf1 A G 9: 107,554,840 Y21C probably damaging Het
Slc12a1 A T 2: 125,188,193 I562F probably damaging Het
Slc16a6 A G 11: 109,458,561 S141P probably damaging Het
Sntn T C 14: 13,679,084 L86P probably damaging Het
Taar4 T A 10: 23,961,015 N174K probably damaging Het
Trav12-3 G T 14: 53,622,029 C44F probably damaging Het
Triml2 A G 8: 43,190,360 R240G probably benign Het
Vmn1r3 A G 4: 3,185,241 M22T probably benign Het
Vmn2r7 C A 3: 64,719,516 Q26H possibly damaging Het
Vmn2r72 T C 7: 85,749,735 D470G possibly damaging Het
Xpo6 A G 7: 126,120,409 Y602H probably damaging Het
Zfp287 T C 11: 62,712,202 T241A probably benign Het
Zfp386 A G 12: 116,060,155 K498E probably damaging Het
Zzef1 T C 11: 72,908,500 L2392P probably damaging Het
Other mutations in Klhl26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Klhl26 APN 8 70451883 missense probably damaging 1.00
IGL02508:Klhl26 APN 8 70452731 missense probably damaging 1.00
IGL03089:Klhl26 APN 8 70455633 missense probably benign 0.05
IGL03144:Klhl26 APN 8 70452564 missense probably damaging 1.00
R0365:Klhl26 UTSW 8 70451829 missense probably damaging 1.00
R0408:Klhl26 UTSW 8 70452480 missense probably damaging 1.00
R0494:Klhl26 UTSW 8 70451601 missense probably damaging 1.00
R1889:Klhl26 UTSW 8 70451733 missense probably damaging 0.99
R1940:Klhl26 UTSW 8 70452261 missense probably damaging 1.00
R4458:Klhl26 UTSW 8 70452692 missense possibly damaging 0.89
R4459:Klhl26 UTSW 8 70451544 missense probably damaging 1.00
R4460:Klhl26 UTSW 8 70451544 missense probably damaging 1.00
R4461:Klhl26 UTSW 8 70451544 missense probably damaging 1.00
R5135:Klhl26 UTSW 8 70452718 missense probably benign 0.19
R5334:Klhl26 UTSW 8 70452318 missense probably damaging 1.00
R5342:Klhl26 UTSW 8 70455565 missense probably damaging 1.00
R5711:Klhl26 UTSW 8 70452324 missense probably damaging 0.98
R5724:Klhl26 UTSW 8 70451754 missense probably damaging 1.00
R5965:Klhl26 UTSW 8 70452731 missense probably damaging 1.00
R7319:Klhl26 UTSW 8 70452942 missense probably damaging 0.99
R7390:Klhl26 UTSW 8 70452849 missense probably damaging 0.98
Z1088:Klhl26 UTSW 8 70451799 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGAAGTTATCCAGCACAGCC -3'
(R):5'- GTCTTCTTTCTGCAGAGCAACC -3'

Sequencing Primer
(F):5'- TATCCAGCACAGCCACGCC -3'
(R):5'- AGATTGACCTGTTCCGCG -3'
Posted On2015-04-17