Incidental Mutation 'R3902:Atmin'
ID309240
Institutional Source Beutler Lab
Gene Symbol Atmin
Ensembl Gene ENSMUSG00000047388
Gene NameATM interactor
Synonymsgpg6, Asciz
MMRRC Submission 040811-MU
Accession Numbers

Ncbi RefSeq: NM_177700.4; MGI:2682328

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3902 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location116943393-116960445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116956297 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 232 (N232S)
Ref Sequence ENSEMBL: ENSMUSP00000104727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109099]
Predicted Effect probably benign
Transcript: ENSMUST00000109099
AA Change: N232S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104727
Gene: ENSMUSG00000047388
AA Change: N232S

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 46 62 N/A INTRINSIC
ZnF_C2H2 80 105 2.49e-1 SMART
ZnF_C2H2 127 156 7.11e0 SMART
ZnF_C2H2 161 181 4.5e1 SMART
ZnF_C2H2 187 210 1.06e2 SMART
low complexity region 289 304 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 4868762; 4881337
Lethality: E16-E19
PHENOTYPE: Mice homozygous for a knock-out allele exhibit fetal lethality, craniofacial defects, midbrain exencephaly, and premature senescence of mouse embryonic fibroblasts. Homozygotes for an ENU-induced mutation exhibit left-right patterning defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Eif2b3 C T 4: 117,022,207 R15W probably damaging Het
Eprs G A 1: 185,379,742 probably null Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbxl20 T A 11: 98,097,035 T61S probably benign Het
Fry A G 5: 150,345,927 E211G probably damaging Het
Gatd1 A G 7: 141,409,101 L215P probably damaging Het
Gm14698 A G X: 68,821,647 M101V probably benign Het
Gm15922 G A 7: 3,737,277 T315I probably damaging Het
Gys2 A G 6: 142,472,800 M1T probably null Het
Hacd4 A C 4: 88,437,501 I49R probably damaging Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Klhl26 T C 8: 70,452,366 D217G probably damaging Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Mettl21a C T 1: 64,608,081 V106I probably benign Het
Mpdz A G 4: 81,307,116 V1427A probably damaging Het
Mug2 A T 6: 122,075,567 D1024V probably damaging Het
Myl7 T A 11: 5,898,430 K38M probably damaging Het
Myl7 T G 11: 5,898,431 K38Q probably damaging Het
Myom2 T C 8: 15,104,165 V701A probably benign Het
Nipbl A G 15: 8,350,246 S1021P possibly damaging Het
Optc A G 1: 133,897,963 M275T probably benign Het
Pclo A T 5: 14,712,522 T385S probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Plekhn1 T A 4: 156,225,669 I63F possibly damaging Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Rassf1 A G 9: 107,554,840 Y21C probably damaging Het
Slc12a1 A T 2: 125,188,193 I562F probably damaging Het
Slc16a6 A G 11: 109,458,561 S141P probably damaging Het
Sntn T C 14: 13,679,084 L86P probably damaging Het
Taar4 T A 10: 23,961,015 N174K probably damaging Het
Trav12-3 G T 14: 53,622,029 C44F probably damaging Het
Triml2 A G 8: 43,190,360 R240G probably benign Het
Vmn1r3 A G 4: 3,185,241 M22T probably benign Het
Vmn2r7 C A 3: 64,719,516 Q26H possibly damaging Het
Vmn2r72 T C 7: 85,749,735 D470G possibly damaging Het
Xpo6 A G 7: 126,120,409 Y602H probably damaging Het
Zfp287 T C 11: 62,712,202 T241A probably benign Het
Zfp386 A G 12: 116,060,155 K498E probably damaging Het
Zzef1 T C 11: 72,908,500 L2392P probably damaging Het
Other mutations in Atmin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Atmin APN 8 116956657 missense probably damaging 1.00
IGL02680:Atmin APN 8 116957497 missense probably damaging 1.00
IGL03355:Atmin APN 8 116957425 nonsense probably null
K3955:Atmin UTSW 8 116957036 nonsense probably null
P0038:Atmin UTSW 8 116957036 nonsense probably null
R1440:Atmin UTSW 8 116957376 missense probably damaging 0.98
R1498:Atmin UTSW 8 116954801 missense probably benign 0.21
R1515:Atmin UTSW 8 116954840 missense possibly damaging 0.87
R2094:Atmin UTSW 8 116957538 missense probably damaging 1.00
R2306:Atmin UTSW 8 116957650 missense probably benign 0.04
R2363:Atmin UTSW 8 116954914 critical splice donor site probably null
R2866:Atmin UTSW 8 116956373 missense probably benign
R3743:Atmin UTSW 8 116956573 missense probably benign 0.02
R3901:Atmin UTSW 8 116956297 missense probably benign 0.00
R4664:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4665:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4666:Atmin UTSW 8 116957959 missense probably damaging 1.00
R5441:Atmin UTSW 8 116957957 missense probably damaging 0.99
R5496:Atmin UTSW 8 116957172 missense probably benign 0.01
R6914:Atmin UTSW 8 116956713 missense probably benign 0.02
R6942:Atmin UTSW 8 116956713 missense probably benign 0.02
R6965:Atmin UTSW 8 116957038 missense probably damaging 1.00
R7172:Atmin UTSW 8 116956542 missense probably damaging 1.00
R7492:Atmin UTSW 8 116956918 missense probably damaging 1.00
R7647:Atmin UTSW 8 116957922 missense possibly damaging 0.86
V7732:Atmin UTSW 8 116956479 missense probably damaging 1.00
X0020:Atmin UTSW 8 116952982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCCAGAGTTAAGCAGCTC -3'
(R):5'- GTTTAACCAGAGCCACCTTGG -3'

Sequencing Primer
(F):5'- GCCAGAGTTAAGCAGCTCCAATC -3'
(R):5'- TGGTAACAGCAACTTCTGGG -3'
Posted On2015-04-17