Incidental Mutation 'R3902:Zzef1'
ID309245
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Namezinc finger, ZZ-type with EF hand domain 1
SynonymsC130099L13Rik, 8430405D05Rik
MMRRC Submission 040811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3902 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72796226-72927120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72908500 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2392 (L2392P)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
Predicted Effect probably damaging
Transcript: ENSMUST00000069395
AA Change: L2363P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: L2363P

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152481
Predicted Effect probably damaging
Transcript: ENSMUST00000172220
AA Change: L2363P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: L2363P

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207107
AA Change: L2392P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Eif2b3 C T 4: 117,022,207 R15W probably damaging Het
Eprs G A 1: 185,379,742 probably null Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbxl20 T A 11: 98,097,035 T61S probably benign Het
Fry A G 5: 150,345,927 E211G probably damaging Het
Gatd1 A G 7: 141,409,101 L215P probably damaging Het
Gm14698 A G X: 68,821,647 M101V probably benign Het
Gm15922 G A 7: 3,737,277 T315I probably damaging Het
Gys2 A G 6: 142,472,800 M1T probably null Het
Hacd4 A C 4: 88,437,501 I49R probably damaging Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Klhl26 T C 8: 70,452,366 D217G probably damaging Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Mettl21a C T 1: 64,608,081 V106I probably benign Het
Mpdz A G 4: 81,307,116 V1427A probably damaging Het
Mug2 A T 6: 122,075,567 D1024V probably damaging Het
Myl7 T A 11: 5,898,430 K38M probably damaging Het
Myl7 T G 11: 5,898,431 K38Q probably damaging Het
Myom2 T C 8: 15,104,165 V701A probably benign Het
Nipbl A G 15: 8,350,246 S1021P possibly damaging Het
Optc A G 1: 133,897,963 M275T probably benign Het
Pclo A T 5: 14,712,522 T385S probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Plekhn1 T A 4: 156,225,669 I63F possibly damaging Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Rassf1 A G 9: 107,554,840 Y21C probably damaging Het
Slc12a1 A T 2: 125,188,193 I562F probably damaging Het
Slc16a6 A G 11: 109,458,561 S141P probably damaging Het
Sntn T C 14: 13,679,084 L86P probably damaging Het
Taar4 T A 10: 23,961,015 N174K probably damaging Het
Trav12-3 G T 14: 53,622,029 C44F probably damaging Het
Triml2 A G 8: 43,190,360 R240G probably benign Het
Vmn1r3 A G 4: 3,185,241 M22T probably benign Het
Vmn2r7 C A 3: 64,719,516 Q26H possibly damaging Het
Vmn2r72 T C 7: 85,749,735 D470G possibly damaging Het
Xpo6 A G 7: 126,120,409 Y602H probably damaging Het
Zfp287 T C 11: 62,712,202 T241A probably benign Het
Zfp386 A G 12: 116,060,155 K498E probably damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 synonymous probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7898:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
R7957:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7981:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GAGAAAGGCTGTTGCTCTGTC -3'
(R):5'- AATACTCCTCCAAGGTTCTTTGAAC -3'

Sequencing Primer
(F):5'- AGGCTGTTGCTCTGTCCAACC -3'
(R):5'- CCAATTCATTTTCCTGGCAGGGG -3'
Posted On2015-04-17