Incidental Mutation 'R3903:Olfr898'
ID309262
Institutional Source Beutler Lab
Gene Symbol Olfr898
Ensembl Gene ENSMUSG00000094588
Gene Nameolfactory receptor 898
SynonymsGA_x6K02T2PVTD-32037624-32038565, MOR170-3
MMRRC Submission 040907-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R3903 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38348411-38352919 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 38349658 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 186 (Q186*)
Ref Sequence ENSEMBL: ENSMUSP00000149554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076504] [ENSMUST00000216304] [ENSMUST00000217063]
Predicted Effect probably null
Transcript: ENSMUST00000076504
AA Change: Q192*
SMART Domains Protein: ENSMUSP00000075824
Gene: ENSMUSG00000094588
AA Change: Q192*

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 2.2e-47 PFAM
Pfam:7tm_1 47 313 1.7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216304
AA Change: Q186*
Predicted Effect probably null
Transcript: ENSMUST00000217063
AA Change: Q186*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amd1 C T 10: 40,290,457 R210H probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Ap3m1 T C 14: 21,036,664 Y185C probably null Het
Calcrl T A 2: 84,368,642 probably benign Het
Ccdc178 C T 18: 22,023,095 V573I possibly damaging Het
Cdh6 T C 15: 13,042,575 K499R probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Cyp4f40 C A 17: 32,659,624 R47S possibly damaging Het
Eif4a2 AG A 16: 23,110,640 probably null Het
Gm595 T C X: 48,841,544 N649S possibly damaging Het
Gm8180 T A 14: 43,783,635 R39W probably null Het
Golm1 T C 13: 59,638,340 Q346R probably damaging Het
Grap T G 11: 61,660,325 probably null Het
Hormad2 A G 11: 4,427,237 probably benign Het
Hyal1 T C 9: 107,578,972 probably null Het
Kif12 A G 4: 63,167,976 V378A possibly damaging Het
Lrrk2 A T 15: 91,747,700 S1276C probably damaging Het
Lrrk2 G A 15: 91,747,701 S1276N probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1276 A T 2: 111,257,769 Y218F probably damaging Het
Olfr1356 T G 10: 78,847,298 I206L probably benign Het
Pabpc6 T C 17: 9,669,154 E156G probably benign Het
Rorb A G 19: 18,962,099 Y155H probably damaging Het
Samd9l T A 6: 3,376,830 K144* probably null Het
Scn1a A G 2: 66,318,132 I3T probably benign Het
Serpinb9 T C 13: 33,010,810 M183T possibly damaging Het
Wnk1 A G 6: 119,949,051 S1151P probably damaging Het
Xirp2 C T 2: 67,508,036 T207I probably benign Het
Zfp39 T C 11: 58,890,175 Y587C probably benign Het
Other mutations in Olfr898
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Olfr898 APN 9 38349805 missense possibly damaging 0.95
IGL02477:Olfr898 APN 9 38349125 missense probably benign 0.16
IGL02858:Olfr898 APN 9 38349173 missense probably benign 0.04
PIT4362001:Olfr898 UTSW 9 38349198 missense probably benign 0.34
R0060:Olfr898 UTSW 9 38349512 missense probably benign 0.23
R0518:Olfr898 UTSW 9 38349203 missense probably damaging 0.99
R0521:Olfr898 UTSW 9 38349203 missense probably damaging 0.99
R0622:Olfr898 UTSW 9 38349371 missense possibly damaging 0.74
R0898:Olfr898 UTSW 9 38349442 missense probably damaging 0.97
R1562:Olfr898 UTSW 9 38349362 nonsense probably null
R4375:Olfr898 UTSW 9 38349169 missense probably benign
R4459:Olfr898 UTSW 9 38349992 missense probably damaging 1.00
R4762:Olfr898 UTSW 9 38349281 missense probably damaging 1.00
R4943:Olfr898 UTSW 9 38349628 missense probably damaging 1.00
R5033:Olfr898 UTSW 9 38349628 missense probably damaging 1.00
R5442:Olfr898 UTSW 9 38349862 missense probably benign 0.06
R5863:Olfr898 UTSW 9 38349787 missense probably benign 0.09
R5988:Olfr898 UTSW 9 38349749 missense probably benign 0.30
R7077:Olfr898 UTSW 9 38349970 missense probably damaging 1.00
R7509:Olfr898 UTSW 9 38349572 missense probably benign 0.26
R7709:Olfr898 UTSW 9 38349277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACAGCCATGGCCTATGATC -3'
(R):5'- TAACAGTTATGATGTGGGACCC -3'

Sequencing Primer
(F):5'- AGCCATGGCCTATGATCGCTATG -3'
(R):5'- GGACCCACAAGTGCCCAG -3'
Posted On2015-04-17