Incidental Mutation 'R3903:Amt'
ID309265
Institutional Source Beutler Lab
Gene Symbol Amt
Ensembl Gene ENSMUSG00000032607
Gene Nameaminomethyltransferase
SynonymsEG434437
MMRRC Submission 040907-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3903 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108296853-108302302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108297221 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 62 (R62C)
Ref Sequence ENSEMBL: ENSMUSP00000035230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035227] [ENSMUST00000035230]
Predicted Effect probably benign
Transcript: ENSMUST00000035227
Predicted Effect possibly damaging
Transcript: ENSMUST00000035230
AA Change: R62C

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035230
Gene: ENSMUSG00000032607
AA Change: R62C

DomainStartEndE-ValueType
Pfam:GCV_T 38 291 7.8e-86 PFAM
Pfam:GCV_T_C 300 392 1.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195695
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of four critical components of the glycine cleavage system. Mutations in this gene have been associated with glycine encephalopathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele develop neural tubes defects at high frequency and exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amd1 C T 10: 40,290,457 R210H probably benign Het
Ap3m1 T C 14: 21,036,664 Y185C probably null Het
Calcrl T A 2: 84,368,642 probably benign Het
Ccdc178 C T 18: 22,023,095 V573I possibly damaging Het
Cdh6 T C 15: 13,042,575 K499R probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Cyp4f40 C A 17: 32,659,624 R47S possibly damaging Het
Eif4a2 AG A 16: 23,110,640 probably null Het
Gm595 T C X: 48,841,544 N649S possibly damaging Het
Gm8180 T A 14: 43,783,635 R39W probably null Het
Golm1 T C 13: 59,638,340 Q346R probably damaging Het
Grap T G 11: 61,660,325 probably null Het
Hormad2 A G 11: 4,427,237 probably benign Het
Hyal1 T C 9: 107,578,972 probably null Het
Kif12 A G 4: 63,167,976 V378A possibly damaging Het
Lrrk2 A T 15: 91,747,700 S1276C probably damaging Het
Lrrk2 G A 15: 91,747,701 S1276N probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1276 A T 2: 111,257,769 Y218F probably damaging Het
Olfr1356 T G 10: 78,847,298 I206L probably benign Het
Olfr898 C T 9: 38,349,658 Q186* probably null Het
Pabpc6 T C 17: 9,669,154 E156G probably benign Het
Rorb A G 19: 18,962,099 Y155H probably damaging Het
Samd9l T A 6: 3,376,830 K144* probably null Het
Scn1a A G 2: 66,318,132 I3T probably benign Het
Serpinb9 T C 13: 33,010,810 M183T possibly damaging Het
Wnk1 A G 6: 119,949,051 S1151P probably damaging Het
Xirp2 C T 2: 67,508,036 T207I probably benign Het
Zfp39 T C 11: 58,890,175 Y587C probably benign Het
Other mutations in Amt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02657:Amt APN 9 108301380 missense probably damaging 1.00
IGL03277:Amt APN 9 108301219 missense probably benign
R1333:Amt UTSW 9 108301097 missense probably benign 0.04
R1856:Amt UTSW 9 108297162 missense probably damaging 1.00
R3843:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3844:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3904:Amt UTSW 9 108297221 missense possibly damaging 0.74
R4729:Amt UTSW 9 108300652 missense probably damaging 1.00
R4814:Amt UTSW 9 108299780 missense probably benign
R5149:Amt UTSW 9 108301451 missense possibly damaging 0.59
R6000:Amt UTSW 9 108301485 missense probably benign 0.20
R6044:Amt UTSW 9 108297251 missense probably damaging 1.00
R6911:Amt UTSW 9 108301229 critical splice donor site probably null
R6957:Amt UTSW 9 108299833 missense possibly damaging 0.51
R7618:Amt UTSW 9 108299878 missense probably damaging 1.00
R7658:Amt UTSW 9 108297231 missense probably damaging 0.98
R7783:Amt UTSW 9 108297215 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTCAGTTCTGTACAGGTGGG -3'
(R):5'- TCTCCTGAGTTAGCCCTCTAGAG -3'

Sequencing Primer
(F):5'- CTCAGTTCTGTACAGGTGGGATAAAG -3'
(R):5'- GAGTTAGCCCTCTAGAGTCCCTAAC -3'
Posted On2015-04-17