Mutagenetix > Incidental Mutation

Incidental Mutation 'R3903:Ap3m1'

309275

Institutional Source

Beutler Lab

Gene Symbol

Ap3m1

Ensembl Gene

ENSMUSG00000021824

Gene Name

adaptor-related protein complex 3, mu 1 subunit

Synonyms

C78982, 1200013D09Rik

MMRRC Submission

040907-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R3903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21083810-21102603 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21086732 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 185 (Y185C)

Ref Sequence

ENSEMBL: ENSMUSP00000153649 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022369] [ENSMUST00000022371] [ENSMUST00000126536] [ENSMUST00000130291] [ENSMUST00000154460] [ENSMUST00000224016]

AlphaFold

Q9JKC8

Predicted Effect

probably benign
Transcript: ENSMUST00000022369

SMART Domains

Protein: ENSMUSP00000022369
Gene: ENSMUSG00000021823

Domain	Start	End	E-Value	Type
Pfam:Vinculin	3	485	9e-203	PFAM
Pfam:Vinculin	475	1066	1.7e-301	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000022371
AA Change: Y345C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022371
Gene: ENSMUSG00000021824
AA Change: Y345C

Domain	Start	End	E-Value	Type
SCOP:d1gw5m2	1	96	1e-23	SMART
Pfam:Adap_comp_sub	111	364	9.1e-77	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122974

Predicted Effect

probably benign
Transcript: ENSMUST00000126536

SMART Domains

Protein: ENSMUSP00000116046
Gene: ENSMUSG00000021824

Domain	Start	End	E-Value	Type
SCOP:d1gw5m2	1	91	9e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000130291

SMART Domains

Protein: ENSMUSP00000118259
Gene: ENSMUSG00000021824

Domain	Start	End	E-Value	Type
Pfam:Clat_adaptor_s	1	138	9e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131469

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148886

Predicted Effect

probably damaging
Transcript: ENSMUST00000154460
AA Change: Y399C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117346
Gene: ENSMUSG00000021824
AA Change: Y399C

Domain	Start	End	E-Value	Type
Pfam:Clat_adaptor_s	1	136	1.8e-8	PFAM
Pfam:Adap_comp_sub	165	418	1e-77	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156716

Predicted Effect

probably null
Transcript: ENSMUST00000224016
AA Change: Y185C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7552

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the medium subunit of AP-3, which is an adaptor-related protein complex associated with the Golgi region as well as more peripheral intracellular structures. AP-3 facilitates the budding of vesicles from the Golgi membrane, and it may directly function in protein sorting to the endosomal/lysosomal system. AP-3 is a heterotetrameric protein complex composed of two large subunits (delta and beta3), a medium subunit (mu3), and a small subunit (sigma 3). Mutations in one of the large subunits of AP-3 have been associated with the Hermansky-Pudlak syndrome, a genetic disorder characterized by defective lysosome-related organelles. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amd1	C	T	10: 40,166,453 (GRCm39)	R210H	probably benign	Het
Amt	C	T	9: 108,174,420 (GRCm39)	R62C	possibly damaging	Het
Calcrl	T	A	2: 84,198,986 (GRCm39)		probably benign	Het
Ccdc178	C	T	18: 22,156,152 (GRCm39)	V573I	possibly damaging	Het
Cdh6	T	C	15: 13,042,661 (GRCm39)	K499R	probably benign	Het
Col1a2	G	A	6: 4,518,822 (GRCm39)		probably benign	Het
Col6a1	C	T	10: 76,547,175 (GRCm39)	R730H	unknown	Het
Cyp4f40	C	A	17: 32,878,598 (GRCm39)	R47S	possibly damaging	Het
Eif4a2	AG	A	16: 22,929,390 (GRCm39)		probably null	Het
Fsip2l	T	C	X: 47,930,421 (GRCm39)	N649S	possibly damaging	Het
Gm8180	T	A	14: 44,021,092 (GRCm39)	R39W	probably null	Het
Golm1	T	C	13: 59,786,154 (GRCm39)	Q346R	probably damaging	Het
Grap	T	G	11: 61,551,151 (GRCm39)		probably null	Het
Hormad2	A	G	11: 4,377,237 (GRCm39)		probably benign	Het
Hyal1	T	C	9: 107,456,171 (GRCm39)		probably null	Het
Kif12	A	G	4: 63,086,213 (GRCm39)	V378A	possibly damaging	Het
Lrrk2	G	A	15: 91,631,904 (GRCm39)	S1276N	probably damaging	Het
Lrrk2	A	T	15: 91,631,903 (GRCm39)	S1276C	probably damaging	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or4f53	A	T	2: 111,088,114 (GRCm39)	Y218F	probably damaging	Het
Or7c70	T	G	10: 78,683,132 (GRCm39)	I206L	probably benign	Het
Or8c20	C	T	9: 38,260,954 (GRCm39)	Q186*	probably null	Het
Pabpc6	T	C	17: 9,888,083 (GRCm39)	E156G	probably benign	Het
Rorb	A	G	19: 18,939,463 (GRCm39)	Y155H	probably damaging	Het
Samd9l	T	A	6: 3,376,830 (GRCm39)	K144*	probably null	Het
Scn1a	A	G	2: 66,148,476 (GRCm39)	I3T	probably benign	Het
Serpinb9	T	C	13: 33,194,793 (GRCm39)	M183T	possibly damaging	Het
Wnk1	A	G	6: 119,926,012 (GRCm39)	S1151P	probably damaging	Het
Xirp2	C	T	2: 67,338,380 (GRCm39)	T207I	probably benign	Het
Zfp39	T	C	11: 58,781,001 (GRCm39)	Y587C	probably benign	Het

Other mutations in Ap3m1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02628:Ap3m1	APN	14	21,095,588 (GRCm39)	nonsense	probably null
IGL02815:Ap3m1	APN	14	21,086,750 (GRCm39)	missense	probably damaging	1.00
R0268:Ap3m1	UTSW	14	21,087,170 (GRCm39)	splice site	probably benign
R1780:Ap3m1	UTSW	14	21,091,138 (GRCm39)	missense	probably benign	0.20
R1961:Ap3m1	UTSW	14	21,091,083 (GRCm39)	missense	probably damaging	1.00
R2029:Ap3m1	UTSW	14	21,089,217 (GRCm39)	missense	possibly damaging	0.94
R4837:Ap3m1	UTSW	14	21,087,225 (GRCm39)	missense	probably damaging	1.00
R4952:Ap3m1	UTSW	14	21,090,134 (GRCm39)	missense	probably benign	0.00
R5050:Ap3m1	UTSW	14	21,094,843 (GRCm39)	missense	probably benign	0.00
R5741:Ap3m1	UTSW	14	21,095,788 (GRCm39)	missense	possibly damaging	0.95
R6761:Ap3m1	UTSW	14	21,088,096 (GRCm39)	missense	probably benign
R7394:Ap3m1	UTSW	14	21,088,147 (GRCm39)	missense	probably benign	0.00
R7487:Ap3m1	UTSW	14	21,088,107 (GRCm39)	missense	probably benign
R7640:Ap3m1	UTSW	14	21,088,243 (GRCm39)	missense	probably benign	0.03
R9156:Ap3m1	UTSW	14	21,090,152 (GRCm39)	missense	probably damaging	0.99
R9331:Ap3m1	UTSW	14	21,095,666 (GRCm39)	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AAGCAACTTTGTTAGCAGGGTAG -3'
(R):5'- AGGCCATGCTCCTTAGAGTAC -3'

Sequencing Primer
(F):5'- TTAGCAGGGTAGCTTGACAC -3'
(R):5'- CATGCTCCTTAGAGTACAGCATGTG -3'

Posted On

2015-04-17