Incidental Mutation 'R3909:Olfr1143'
ID309290
Institutional Source Beutler Lab
Gene Symbol Olfr1143
Ensembl Gene ENSMUSG00000068815
Gene Nameolfactory receptor 1143
SynonymsGA_x6K02T2Q125-49303473-49304405, MOR177-14
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3909 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87800592-87804274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87802687 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 95 (F95L)
Ref Sequence ENSEMBL: ENSMUSP00000107194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090708] [ENSMUST00000099852] [ENSMUST00000111568]
Predicted Effect probably benign
Transcript: ENSMUST00000090708
AA Change: F99L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088210
Gene: ENSMUSG00000068815
AA Change: F99L

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.6e-45 PFAM
Pfam:7tm_1 45 294 5.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099852
AA Change: F95L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097438
Gene: ENSMUSG00000068815
AA Change: F95L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-41 PFAM
Pfam:7tm_1 41 290 4.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111568
AA Change: F95L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107194
Gene: ENSMUSG00000068815
AA Change: F95L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-44 PFAM
Pfam:7tm_1 41 290 2.8e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Olfr1143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Olfr1143 APN 2 87803200 nonsense probably null
IGL01670:Olfr1143 APN 2 87802880 missense probably benign 0.10
IGL02503:Olfr1143 APN 2 87802520 missense probably benign 0.01
R0316:Olfr1143 UTSW 2 87803181 missense probably damaging 0.98
R1381:Olfr1143 UTSW 2 87803136 missense probably damaging 1.00
R1496:Olfr1143 UTSW 2 87802868 missense probably benign 0.00
R1753:Olfr1143 UTSW 2 87802762 missense probably benign 0.06
R2013:Olfr1143 UTSW 2 87802503 missense probably damaging 0.97
R2370:Olfr1143 UTSW 2 87802815 missense probably benign 0.35
R3810:Olfr1143 UTSW 2 87803052 missense possibly damaging 0.90
R3812:Olfr1143 UTSW 2 87803052 missense possibly damaging 0.90
R4227:Olfr1143 UTSW 2 87802875 missense probably damaging 0.97
R5753:Olfr1143 UTSW 2 87803252 missense probably benign 0.05
R6516:Olfr1143 UTSW 2 87802770 missense possibly damaging 0.81
Z1177:Olfr1143 UTSW 2 87803228 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGTAAAAGTGGTTCTGTTCAC -3'
(R):5'- GGATCAAAGAGTCTGCCACAC -3'

Sequencing Primer
(F):5'- TGGTCTATCTAATCAATCTCATTGGG -3'
(R):5'- GAGTCTGCCACACCTACAAAATAAAC -3'
Posted On2015-04-17