Incidental Mutation 'R3909:Olfr1153'
ID309291
Institutional Source Beutler Lab
Gene Symbol Olfr1153
Ensembl Gene ENSMUSG00000048197
Gene Nameolfactory receptor 1153
SynonymsGA_x6K02T2Q125-49395950-49396882, MOR177-7
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R3909 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87894962-87898310 bp(+) (GRCm38)
Type of Mutationsplice site (4307 bp from exon)
DNA Base Change (assembly) T to A at 87896949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052300] [ENSMUST00000215017] [ENSMUST00000215862] [ENSMUST00000217436]
Predicted Effect probably damaging
Transcript: ENSMUST00000052300
AA Change: F258Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057839
Gene: ENSMUSG00000048197
AA Change: F258Y

DomainStartEndE-ValueType
Pfam:7tm_4 38 315 4.9e-45 PFAM
Pfam:7tm_1 48 297 5.9e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215017
Predicted Effect probably null
Transcript: ENSMUST00000215862
Predicted Effect possibly damaging
Transcript: ENSMUST00000217436
AA Change: F250Y

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.2932 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Olfr1153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Olfr1153 APN 2 87896921 missense probably benign 0.00
IGL02024:Olfr1153 APN 2 87896899 missense possibly damaging 0.81
IGL02219:Olfr1153 APN 2 87896973 missense possibly damaging 0.93
IGL02693:Olfr1153 APN 2 87896533 missense probably damaging 1.00
R0121:Olfr1153 UTSW 2 87897090 missense possibly damaging 0.93
R0315:Olfr1153 UTSW 2 87897066 missense probably damaging 1.00
R0446:Olfr1153 UTSW 2 87896855 missense possibly damaging 0.51
R0472:Olfr1153 UTSW 2 87896493 missense possibly damaging 0.47
R0720:Olfr1153 UTSW 2 87896669 missense probably benign 0.31
R1579:Olfr1153 UTSW 2 87896942 missense probably benign 0.05
R1968:Olfr1153 UTSW 2 87897039 missense probably damaging 1.00
R4936:Olfr1153 UTSW 2 87896813 missense probably benign 0.06
R5520:Olfr1153 UTSW 2 87896409 unclassified probably benign
R5585:Olfr1153 UTSW 2 87896675 missense possibly damaging 0.54
R6176:Olfr1153 UTSW 2 87896936 missense probably benign 0.18
R6272:Olfr1153 UTSW 2 87896657 missense probably benign 0.00
R6451:Olfr1153 UTSW 2 87896591 missense probably damaging 1.00
R7312:Olfr1153 UTSW 2 87896411 missense possibly damaging 0.54
R7350:Olfr1153 UTSW 2 87896409 unclassified probably benign
R8060:Olfr1153 UTSW 2 87896973 missense probably damaging 1.00
R8752:Olfr1153 UTSW 2 87896247 missense possibly damaging 0.66
Z1088:Olfr1153 UTSW 2 87896633 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTTCAGATACAGAGGTCAATGAAC -3'
(R):5'- CAGCCACTTGAGCCTTAGATC -3'

Sequencing Primer
(F):5'- GGTCAATGAACTAGTTATATTCACCC -3'
(R):5'- AAATGAAATTCTACTTTTCAGGGACC -3'
Posted On2015-04-17