Incidental Mutation 'R3909:Mxd1'
ID309299
Institutional Source Beutler Lab
Gene Symbol Mxd1
Ensembl Gene ENSMUSG00000001156
Gene NameMAX dimerization protein 1
SynonymsMad1, Mad
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R3909 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86647042-86669161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86650960 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 199 (Q199K)
Ref Sequence ENSEMBL: ENSMUSP00000001184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001184] [ENSMUST00000203946] [ENSMUST00000204437]
Predicted Effect probably benign
Transcript: ENSMUST00000001184
AA Change: Q199K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001184
Gene: ENSMUSG00000001156
AA Change: Q199K

DomainStartEndE-ValueType
PDB:1PD7|B 5 28 6e-7 PDB
HLH 61 113 1.14e-9 SMART
low complexity region 143 175 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203946
SMART Domains Protein: ENSMUSP00000145081
Gene: ENSMUSG00000001156

DomainStartEndE-ValueType
HLH 6 58 4.8e-12 SMART
low complexity region 88 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204437
SMART Domains Protein: ENSMUSP00000145396
Gene: ENSMUSG00000001156

DomainStartEndE-ValueType
PDB:1PD7|B 5 28 3e-8 PDB
Meta Mutation Damage Score 0.1005 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYC/MAX/MAD network of basic helix-loop-helix leucine zipper transcription factors. The MYC/MAX/MAD transcription factors mediate cellular proliferation, differentiation and apoptosis. The encoded protein antagonizes MYC-mediated transcriptional activation of target genes by competing for the binding partner MAX and recruiting repressor complexes containing histone deacetylases. Mutations in this gene may play a role in acute leukemia, and the encoded protein is a potential tumor suppressor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myelopoiesis, increased proliferative potential of bone marrow granulocytic precursors, increased sensitivity of myeloid cells to apoptosis-inducing stimuli, and inhibited cell cycle withdrawal during a late stage of granulocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Mxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
LCD18:Mxd1 UTSW 6 86667406 intron probably benign
R1385:Mxd1 UTSW 6 86651567 missense probably damaging 0.96
R1510:Mxd1 UTSW 6 86653155 missense possibly damaging 0.96
R1595:Mxd1 UTSW 6 86651471 missense possibly damaging 0.93
R2126:Mxd1 UTSW 6 86651440 critical splice donor site probably null
R3905:Mxd1 UTSW 6 86650960 missense probably benign 0.44
R3907:Mxd1 UTSW 6 86650960 missense probably benign 0.44
R6048:Mxd1 UTSW 6 86650984 missense probably damaging 1.00
R7060:Mxd1 UTSW 6 86653159 missense probably damaging 1.00
R7351:Mxd1 UTSW 6 86651466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCAAAGTGGACAGAGC -3'
(R):5'- GTAAGAGTTAGGTAGCCAAGCC -3'

Sequencing Primer
(F):5'- CAGAGCTGCTATTGGTCAAGG -3'
(R):5'- TTAGGTAGCCAAGCCCAAGG -3'
Posted On2015-04-17