Mutagenetix > Incidental Mutations

Incidental Mutation 'R0380:Cckbr'

30930

Institutional Source

Beutler Lab

Gene Symbol

Cckbr

Ensembl Gene

ENSMUSG00000030898

Gene Name

cholecystokinin B receptor

Synonyms

CCK2/gastrin, CCK2R, CCKR-2, CCK-B/gastrin receptor

MMRRC Submission

038586-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R0380 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

105425731-105470898 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105434991 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 311 (T311A)

Ref Sequence

ENSEMBL: ENSMUSP00000033189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033189] [ENSMUST00000181339]

Predicted Effect

probably benign
Transcript: ENSMUST00000033189
AA Change: T311A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000033189
Gene: ENSMUSG00000030898
AA Change: T311A

Domain	Start	End	E-Value	Type
low complexity region	9	21	N/A	INTRINSIC
low complexity region	27	38	N/A	INTRINSIC
Pfam:7tm_1	71	396	4.1e-59	PFAM
low complexity region	409	434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000181339

SMART Domains

Protein: ENSMUSP00000138052
Gene: ENSMUSG00000030898

Domain	Start	End	E-Value	Type
low complexity region	9	21	N/A	INTRINSIC
low complexity region	27	38	N/A	INTRINSIC
Pfam:7tm_1	71	301	3.3e-49	PFAM

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.6%
20x: 90.5%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: This gene encodes a multipass transmembrane receptor protein expressed in the central nervous system and gastrointestinal tract. Cholecystokinin and gastrin bind to the encoded protein to stimulate gastric acid secretion and mucosal growth in the gastrointestinal tract, and anxiety, pain sensation and memory in the brain. Mice lacking the encoded protein exhibit an increase in the basal gastric pH and gastrin levels in the bloodstream as well as mild hypocalcemia, secondary hyperparathyroidism and increased bone resorption. [provided by RefSeq, Apr 2015]
PHENOTYPE: Nullizygous mice show gastic mucoca defects, high gastic pH and hypergastrenemia. Homozygotes for a null allele also exhibit higher energy intake and expenditure, less susceptibility to endotoxin shock, altered pain and mechanical sensitivity, and behavioral changes to isolation and addictive drugs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,588,500		probably null	Het
Abca14	A	T	7: 120,278,480	I1073L	probably benign	Het
Adamts17	C	T	7: 67,150,044	P1116L	probably benign	Het
Adgrb2	C	G	4: 130,007,831	P416R	probably damaging	Het
Ano4	A	G	10: 88,978,813	I671T	possibly damaging	Het
Ap1g1	A	G	8: 109,803,164		probably benign	Het
Arhgap19	A	G	19: 41,773,137		probably benign	Het
Arhgap32	C	T	9: 32,246,477	R129W	probably damaging	Het
Atp10b	G	T	11: 43,225,597	A924S	probably damaging	Het
Ccdc180	T	A	4: 45,930,197		probably null	Het
Cr2	C	T	1: 195,157,407	G947R	probably damaging	Het
Cyp2g1	T	A	7: 26,814,295		probably benign	Het
Dennd1c	G	A	17: 57,073,822	A210V	probably damaging	Het
Doxl2	A	G	6: 48,975,839	I233V	probably benign	Het
Dscam	A	G	16: 97,056,610	Y67H	probably damaging	Het
Dsg2	T	A	18: 20,582,939	Y282*	probably null	Het
Epg5	T	C	18: 77,960,841	L688P	probably damaging	Het
Esr2	T	G	12: 76,123,291	E458A	possibly damaging	Het
Fat1	T	C	8: 45,010,123	S1326P	probably damaging	Het
Flt1	A	G	5: 147,588,572	S919P	probably damaging	Het
Gpr12	T	A	5: 146,583,336	T259S	probably damaging	Het
Grm5	T	A	7: 88,074,376	C625S	possibly damaging	Het
H2-Q1	C	T	17: 35,323,078	H209Y	probably damaging	Het
Hcfc2	C	A	10: 82,728,438		probably benign	Het
Itgal	C	A	7: 127,310,751	Y495*	probably null	Het
Kbtbd3	T	A	9: 4,330,545	Y306*	probably null	Het
Kcns2	T	C	15: 34,839,172	F227S	possibly damaging	Het
Kif1a	T	A	1: 93,056,031		probably null	Het
Maml2	C	T	9: 13,621,100	R537*	probably null	Het
Muc4	G	A	16: 32,752,905	A928T	probably benign	Het
Nav3	A	G	10: 109,758,879		probably benign	Het
Neb	A	T	2: 52,232,202	M605K	probably damaging	Het
Olfr15	A	T	16: 3,838,985	D4V	probably benign	Het
Pcdhb3	T	G	18: 37,302,157	I392S	possibly damaging	Het
Prune2	A	G	19: 17,124,007	T2292A	probably damaging	Het
Rbbp8nl	A	T	2: 180,281,719	M108K	probably damaging	Het
Rbm25	A	G	12: 83,660,356	T259A	probably benign	Het
Recql	C	A	6: 142,369,430	R243L	probably damaging	Het
Rsf1	TGGCG	TGGCGACGGCGGCG	7: 97,579,905		probably benign	Het
Serpinb12	T	C	1: 106,950,821		probably null	Het
Slc16a14	T	A	1: 84,929,530	I8F	possibly damaging	Het
Spef1	G	T	2: 131,172,412		probably benign	Het
Tas2r103	A	G	6: 133,036,203	L300P	probably damaging	Het
Tas2r117	A	T	6: 132,803,588	R230*	probably null	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Thnsl2	A	T	6: 71,141,330	L38Q	probably damaging	Het
Tmem171	G	T	13: 98,692,027	T205K	possibly damaging	Het
Tmem232	A	T	17: 65,256,448	L650Q	probably benign	Het
Tpr	T	A	1: 150,412,947	D518E	probably benign	Het
Tsen54	T	C	11: 115,822,597	V442A	probably damaging	Het
Tshz3	A	T	7: 36,771,300	I905F	probably damaging	Het
Vmn1r66	C	T	7: 10,274,743	C121Y	probably benign	Het
Wdfy3	T	C	5: 101,948,966	Q322R	probably damaging	Het
Wdr64	T	C	1: 175,769,642		probably benign	Het

Other mutations in Cckbr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Cckbr	APN	7	105434242	missense	probably benign	0.01
IGL01630:Cckbr	APN	7	105434086	missense	probably damaging	1.00
IGL01931:Cckbr	APN	7	105426103	missense	probably benign
IGL01955:Cckbr	APN	7	105434962	missense	probably damaging	0.97
IGL02219:Cckbr	APN	7	105434048	missense	probably damaging	1.00
IGL02820:Cckbr	APN	7	105434031	missense	probably damaging	1.00
IGL02858:Cckbr	APN	7	105434031	missense	probably damaging	1.00
IGL02878:Cckbr	APN	7	105434031	missense	probably damaging	1.00
IGL02946:Cckbr	APN	7	105434031	missense	probably damaging	1.00
IGL03179:Cckbr	APN	7	105434923	missense	probably benign	0.02
FR4548:Cckbr	UTSW	7	105434681	small deletion	probably benign
R1767:Cckbr	UTSW	7	105434551	missense	possibly damaging	0.56
R3890:Cckbr	UTSW	7	105426169	missense	probably benign	0.00
R3892:Cckbr	UTSW	7	105426169	missense	probably benign	0.00
R5116:Cckbr	UTSW	7	105433655	missense	probably damaging	1.00
R5589:Cckbr	UTSW	7	105434525	missense	probably damaging	0.98
R5975:Cckbr	UTSW	7	105470619	missense	probably benign	0.07
R6797:Cckbr	UTSW	7	105434566	missense	possibly damaging	0.85
R6940:Cckbr	UTSW	7	105434896	missense	probably benign	0.00
R7194:Cckbr	UTSW	7	105435345	missense	possibly damaging	0.72
R7293:Cckbr	UTSW	7	105434645	missense	probably benign	0.05
R7581:Cckbr	UTSW	7	105433786	missense	probably benign	0.05
R7793:Cckbr	UTSW	7	105433591	missense	probably benign	0.00
R7891:Cckbr	UTSW	7	105435350	missense	probably benign	0.00
R8435:Cckbr	UTSW	7	105426073	missense	probably benign
RF009:Cckbr	UTSW	7	105434686	frame shift	probably null
RF039:Cckbr	UTSW	7	105434686	frame shift	probably null
RF062:Cckbr	UTSW	7	105434687	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTTGGTGATGGGCATGAACTCC -3'
(R):5'- TCGGCGGTGCATGAAACAGTAG -3'

Sequencing Primer
(F):5'- ATGGGCATGAACTCCTTACTTG -3'
(R):5'- TGTAGCTCAGCAAGTGGATG -3'

Posted On

2013-04-24