Incidental Mutation 'R3909:Vmn2r38'
ID309303
Institutional Source Beutler Lab
Gene Symbol Vmn2r38
Ensembl Gene ENSMUSG00000095773
Gene Namevomeronasal 2, receptor 38
Synonyms
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3909 (G1)
Quality Score157
Status Not validated
Chromosome7
Chromosomal Location9073835-9097881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9075554 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 610 (K610E)
Ref Sequence ENSEMBL: ENSMUSP00000104194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108554]
Predicted Effect probably damaging
Transcript: ENSMUST00000108554
AA Change: K610E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104194
Gene: ENSMUSG00000095773
AA Change: K610E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 3.5e-33 PFAM
Pfam:NCD3G 512 565 1.4e-20 PFAM
Pfam:7tm_3 598 833 6.4e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Vmn2r38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02805:Vmn2r38 APN 7 9075547 missense probably damaging 0.99
IGL03199:Vmn2r38 APN 7 9075376 missense probably damaging 1.00
R1619:Vmn2r38 UTSW 7 9075533 missense probably damaging 1.00
R3154:Vmn2r38 UTSW 7 9094690 missense probably benign 0.03
R4302:Vmn2r38 UTSW 7 9097563 splice site probably null
R5106:Vmn2r38 UTSW 7 9075170 missense possibly damaging 0.85
R5187:Vmn2r38 UTSW 7 9097572 missense probably benign 0.03
R5575:Vmn2r38 UTSW 7 9075636 nonsense probably null
R5653:Vmn2r38 UTSW 7 9097765 start codon destroyed probably null 1.00
R6156:Vmn2r38 UTSW 7 9094612 missense probably damaging 0.99
R6970:Vmn2r38 UTSW 7 9075341 nonsense probably null
R7107:Vmn2r38 UTSW 7 9090729 missense probably benign 0.00
R7231:Vmn2r38 UTSW 7 9097638 missense possibly damaging 0.88
R7419:Vmn2r38 UTSW 7 9075355 missense probably damaging 1.00
R7963:Vmn2r38 UTSW 7 9092855 missense probably benign 0.17
R8788:Vmn2r38 UTSW 7 9075483 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACTGTTTTGGCCAGAACTG -3'
(R):5'- CAGACCTAACTAAGCTTTCCTTTGG -3'

Sequencing Primer
(F):5'- TTTTGGCCAGAACTGTGGAAAC -3'
(R):5'- TGGAAATCAGATATGGATCAATGTG -3'
Posted On2015-04-17