Incidental Mutation 'R3909:Hyls1'
ID309308
Institutional Source Beutler Lab
Gene Symbol Hyls1
Ensembl Gene ENSMUSG00000050555
Gene NameHYLS1, centriolar and ciliogenesis associated
Synonyms3010015K02Rik
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R3909 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35560820-35570398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35561409 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 237 (D237G)
Ref Sequence ENSEMBL: ENSMUSP00000110762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034612] [ENSMUST00000034615] [ENSMUST00000115110] [ENSMUST00000121246]
Predicted Effect probably benign
Transcript: ENSMUST00000034612
SMART Domains Protein: ENSMUSP00000034612
Gene: ENSMUSG00000032101

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 101 111 N/A INTRINSIC
DEXDc 117 316 1.26e-41 SMART
HELICc 353 440 6.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034615
SMART Domains Protein: ENSMUSP00000034615
Gene: ENSMUSG00000032103

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 6.8e-12 PFAM
Pfam:PseudoU_synth_1 213 331 4.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115110
AA Change: D237G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110762
Gene: ENSMUSG00000050555
AA Change: D237G

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
Pfam:HYLS1_C 211 299 6.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121246
SMART Domains Protein: ENSMUSP00000113382
Gene: ENSMUSG00000032103

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 3e-12 PFAM
Pfam:PseudoU_synth_1 213 316 1.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135768
Meta Mutation Damage Score 0.1615 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized to the cytoplasm. Mutations in this gene are associated with hydrolethalus syndrome. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Hyls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Hyls1 APN 9 35561924 nonsense probably null
IGL00964:Hyls1 APN 9 35562112 intron probably benign
IGL01936:Hyls1 APN 9 35562067 missense probably benign
IGL02979:Hyls1 APN 9 35561674 missense probably benign 0.00
R0519:Hyls1 UTSW 9 35561203 missense probably damaging 1.00
R0894:Hyls1 UTSW 9 35561232 missense probably damaging 1.00
R2302:Hyls1 UTSW 9 35564069 missense possibly damaging 0.55
R4111:Hyls1 UTSW 9 35561418 missense probably damaging 1.00
R4113:Hyls1 UTSW 9 35561418 missense probably damaging 1.00
R5725:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5727:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5833:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5834:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5835:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6030:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6030:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6031:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6031:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6037:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6037:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6269:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6270:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6271:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R8685:Hyls1 UTSW 9 35561428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAGCTTCTTGGGCATG -3'
(R):5'- GGAATTTCACAAGAAGATCAGCTC -3'

Sequencing Primer
(F):5'- TTGGGCATGACACCATTTGCAAG -3'
(R):5'- TCACAAGAAGATCAGCTCATTTGC -3'
Posted On2015-04-17