Incidental Mutation 'R3909:Zfc3h1'
ID 309311
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Name zinc finger, C3H1-type containing
Synonyms Ccdc131, Psrc2
MMRRC Submission 040814-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R3909 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 115220864-115268677 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115255806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1486 (F1486L)
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
AlphaFold B2RT41
Predicted Effect probably benign
Transcript: ENSMUST00000036044
AA Change: F1486L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: F1486L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Meta Mutation Damage Score 0.1348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,625,125 (GRCm39) F501Y probably damaging Het
Alk T C 17: 72,204,906 (GRCm39) T1089A probably benign Het
Ankrd12 G T 17: 66,291,000 (GRCm39) P1478T probably benign Het
Arhgap39 A G 15: 76,636,088 (GRCm39) V49A probably benign Het
Arid4b T C 13: 14,307,069 (GRCm39) L108P probably damaging Het
Atrn T A 2: 130,836,127 (GRCm39) C1136S probably damaging Het
Cacna1s T A 1: 136,012,007 (GRCm39) M483K probably damaging Het
Cacng1 C A 11: 107,607,118 (GRCm39) V34L probably benign Het
Casp8 T C 1: 58,883,970 (GRCm39) S446P probably damaging Het
Cngb3 G A 4: 19,461,679 (GRCm39) C520Y probably damaging Het
Crim1 C T 17: 78,588,668 (GRCm39) probably benign Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Fbxl17 G A 17: 63,806,802 (GRCm39) P71S possibly damaging Het
Fn1 C T 1: 71,647,072 (GRCm39) G1482R probably damaging Het
Gbp3 C T 3: 142,272,099 (GRCm39) probably benign Het
Golga4 A G 9: 118,387,804 (GRCm39) D1642G possibly damaging Het
Hspa1a C T 17: 35,190,703 (GRCm39) V67M probably damaging Het
Hyls1 T C 9: 35,472,705 (GRCm39) D237G probably damaging Het
Kmt2e A G 5: 23,706,624 (GRCm39) N1396D probably benign Het
Lasp1 G A 11: 97,690,653 (GRCm39) V12M probably damaging Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Muc5b C T 7: 141,403,235 (GRCm39) T732M unknown Het
Mxd1 G T 6: 86,627,942 (GRCm39) Q199K probably benign Het
Or14a258 T A 7: 86,035,182 (GRCm39) T229S probably benign Het
Or4a78 T C 2: 89,497,357 (GRCm39) E291G probably damaging Het
Or5w18 T A 2: 87,633,031 (GRCm39) F95L probably benign Het
Or5w20 T A 2: 87,727,293 (GRCm39) probably null Het
Prps1l1 A T 12: 35,035,797 (GRCm39) H304L possibly damaging Het
Psmd2 A G 16: 20,474,392 (GRCm39) D316G probably benign Het
Rlf G A 4: 121,006,229 (GRCm39) T917I probably benign Het
Ryr3 T C 2: 112,466,953 (GRCm39) D4704G probably damaging Het
Scn1a T A 2: 66,104,332 (GRCm39) I1643F probably damaging Het
Vmn2r38 T C 7: 9,078,553 (GRCm39) K610E probably damaging Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115,255,737 (GRCm39) missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115,252,779 (GRCm39) missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115,259,353 (GRCm39) missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115,259,128 (GRCm39) missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115,263,004 (GRCm39) missense probably benign
IGL02382:Zfc3h1 APN 10 115,252,781 (GRCm39) nonsense probably null
IGL02397:Zfc3h1 APN 10 115,243,890 (GRCm39) missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115,247,859 (GRCm39) missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115,236,809 (GRCm39) missense probably benign 0.42
Gnatcatcher UTSW 10 115,236,647 (GRCm39) missense probably benign 0.39
hutton UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
passerine UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R0178_Zfc3h1_655 UTSW 10 115,242,630 (GRCm39) splice site probably benign
vireo UTSW 10 115,255,806 (GRCm39) missense probably benign 0.01
warbler UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115,226,794 (GRCm39) missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115,262,944 (GRCm39) nonsense probably null
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115,251,192 (GRCm39) missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115,242,630 (GRCm39) splice site probably benign
R0355:Zfc3h1 UTSW 10 115,245,018 (GRCm39) missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115,256,715 (GRCm39) missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115,246,537 (GRCm39) missense probably benign 0.00
R0828:Zfc3h1 UTSW 10 115,237,612 (GRCm39) missense possibly damaging 0.68
R0866:Zfc3h1 UTSW 10 115,263,621 (GRCm39) missense probably benign 0.00
R1196:Zfc3h1 UTSW 10 115,247,866 (GRCm39) missense probably damaging 0.99
R1455:Zfc3h1 UTSW 10 115,248,013 (GRCm39) missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115,252,647 (GRCm39) missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115,226,827 (GRCm39) missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115,242,806 (GRCm39) splice site probably null
R1959:Zfc3h1 UTSW 10 115,259,158 (GRCm39) missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115,246,428 (GRCm39) splice site probably benign
R3691:Zfc3h1 UTSW 10 115,256,595 (GRCm39) missense probably benign
R4235:Zfc3h1 UTSW 10 115,254,704 (GRCm39) missense probably benign 0.32
R4684:Zfc3h1 UTSW 10 115,259,290 (GRCm39) missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115,251,599 (GRCm39) missense probably benign 0.16
R4881:Zfc3h1 UTSW 10 115,236,647 (GRCm39) missense probably benign 0.39
R4883:Zfc3h1 UTSW 10 115,246,547 (GRCm39) missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115,240,116 (GRCm39) missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5069:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5070:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5155:Zfc3h1 UTSW 10 115,248,026 (GRCm39) missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115,254,597 (GRCm39) missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115,246,598 (GRCm39) missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115,236,815 (GRCm39) missense probably benign 0.44
R5935:Zfc3h1 UTSW 10 115,267,262 (GRCm39) intron probably benign
R6165:Zfc3h1 UTSW 10 115,256,574 (GRCm39) missense probably benign 0.30
R6182:Zfc3h1 UTSW 10 115,226,764 (GRCm39) missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115,249,881 (GRCm39) missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115,243,813 (GRCm39) missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115,237,653 (GRCm39) missense probably damaging 1.00
R6539:Zfc3h1 UTSW 10 115,247,907 (GRCm39) missense probably benign 0.26
R6723:Zfc3h1 UTSW 10 115,256,638 (GRCm39) missense probably benign 0.34
R7339:Zfc3h1 UTSW 10 115,239,205 (GRCm39) missense probably damaging 1.00
R7381:Zfc3h1 UTSW 10 115,260,535 (GRCm39) missense probably benign
R7404:Zfc3h1 UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
R7667:Zfc3h1 UTSW 10 115,246,606 (GRCm39) nonsense probably null
R7748:Zfc3h1 UTSW 10 115,236,720 (GRCm39) missense probably benign 0.27
R7910:Zfc3h1 UTSW 10 115,256,588 (GRCm39) nonsense probably null
R7914:Zfc3h1 UTSW 10 115,239,062 (GRCm39) splice site probably null
R8023:Zfc3h1 UTSW 10 115,256,553 (GRCm39) missense probably damaging 1.00
R8169:Zfc3h1 UTSW 10 115,254,616 (GRCm39) missense probably damaging 0.98
R8358:Zfc3h1 UTSW 10 115,240,198 (GRCm39) missense probably benign 0.13
R8746:Zfc3h1 UTSW 10 115,243,885 (GRCm39) missense probably damaging 1.00
R8803:Zfc3h1 UTSW 10 115,247,800 (GRCm39) missense probably benign
R8905:Zfc3h1 UTSW 10 115,259,383 (GRCm39) missense probably benign 0.05
R9045:Zfc3h1 UTSW 10 115,263,319 (GRCm39) missense possibly damaging 0.49
R9164:Zfc3h1 UTSW 10 115,259,374 (GRCm39) missense probably benign 0.17
R9211:Zfc3h1 UTSW 10 115,248,328 (GRCm39) missense possibly damaging 0.83
R9216:Zfc3h1 UTSW 10 115,221,528 (GRCm39) missense unknown
R9305:Zfc3h1 UTSW 10 115,255,771 (GRCm39) missense probably benign 0.19
R9372:Zfc3h1 UTSW 10 115,221,223 (GRCm39) missense unknown
R9394:Zfc3h1 UTSW 10 115,254,600 (GRCm39) missense probably damaging 1.00
R9414:Zfc3h1 UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R9538:Zfc3h1 UTSW 10 115,221,197 (GRCm39) missense unknown
R9623:Zfc3h1 UTSW 10 115,259,362 (GRCm39) missense possibly damaging 0.94
R9633:Zfc3h1 UTSW 10 115,247,852 (GRCm39) missense probably damaging 1.00
R9747:Zfc3h1 UTSW 10 115,244,821 (GRCm39) missense possibly damaging 0.58
Z1176:Zfc3h1 UTSW 10 115,243,907 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGAATTGTACATCTGTTGAGAC -3'
(R):5'- GACTTAGCTGGACAGTGACTAAC -3'

Sequencing Primer
(F):5'- GCACCTAGAAAGCACCTT -3'
(R):5'- GGGAACAAAAGTTAAATGTCACCAC -3'
Posted On 2015-04-17