Incidental Mutation 'R3909:Lasp1'
ID 309312
Institutional Source Beutler Lab
Gene Symbol Lasp1
Ensembl Gene ENSMUSG00000038366
Gene Name LIM and SH3 protein 1
Synonyms SH3P6, Def-4
MMRRC Submission 040814-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R3909 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 97689826-97729590 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 97690653 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 12 (V12M)
Ref Sequence ENSEMBL: ENSMUSP00000116102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043843] [ENSMUST00000127033] [ENSMUST00000129558] [ENSMUST00000129828] [ENSMUST00000134428] [ENSMUST00000136723] [ENSMUST00000143571] [ENSMUST00000146572] [ENSMUST00000152962]
AlphaFold Q61792
Predicted Effect probably damaging
Transcript: ENSMUST00000043843
AA Change: V12M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042123
Gene: ENSMUSG00000038366
AA Change: V12M

DomainStartEndE-ValueType
LIM 4 56 4.34e-15 SMART
NEBU 62 92 1.1e-8 SMART
NEBU 98 128 1.05e-9 SMART
low complexity region 174 180 N/A INTRINSIC
SH3 207 263 8.11e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107569
Predicted Effect probably benign
Transcript: ENSMUST00000127033
SMART Domains Protein: ENSMUSP00000127792
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
Pfam:Nebulin 31 59 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129558
SMART Domains Protein: ENSMUSP00000123165
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129828
SMART Domains Protein: ENSMUSP00000115308
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134428
Predicted Effect probably benign
Transcript: ENSMUST00000136723
SMART Domains Protein: ENSMUSP00000114306
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
Pfam:Nebulin 31 59 1.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143571
AA Change: V12M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000146572
SMART Domains Protein: ENSMUSP00000121907
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
Pfam:Nebulin 31 59 2.1e-12 PFAM
Pfam:Nebulin 67 89 1.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152962
SMART Domains Protein: ENSMUSP00000120645
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Meta Mutation Damage Score 0.8629 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM proteins, characterized by a LIM motif and a domain of Src homology region 3, and also a member of the nebulin family of actin-binding proteins. The encoded protein is a cAMP and cGMP dependent signaling protein and binds to the actin cytoskeleton at extensions of the cell membrane. The encoded protein has been linked to metastatic breast cancer, hematopoetic tumors such as B-cell lymphomas, and colorectal cancer. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced histamine-stimulated gastric acid secretion and enlarged heart and testes on a mixed background. Mice homozygous for a transgene insertion exhibit abnormal tail vertebrae with scoliosis, transient spina bifida occulta, and a bent tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,625,125 (GRCm39) F501Y probably damaging Het
Alk T C 17: 72,204,906 (GRCm39) T1089A probably benign Het
Ankrd12 G T 17: 66,291,000 (GRCm39) P1478T probably benign Het
Arhgap39 A G 15: 76,636,088 (GRCm39) V49A probably benign Het
Arid4b T C 13: 14,307,069 (GRCm39) L108P probably damaging Het
Atrn T A 2: 130,836,127 (GRCm39) C1136S probably damaging Het
Cacna1s T A 1: 136,012,007 (GRCm39) M483K probably damaging Het
Cacng1 C A 11: 107,607,118 (GRCm39) V34L probably benign Het
Casp8 T C 1: 58,883,970 (GRCm39) S446P probably damaging Het
Cngb3 G A 4: 19,461,679 (GRCm39) C520Y probably damaging Het
Crim1 C T 17: 78,588,668 (GRCm39) probably benign Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Fbxl17 G A 17: 63,806,802 (GRCm39) P71S possibly damaging Het
Fn1 C T 1: 71,647,072 (GRCm39) G1482R probably damaging Het
Gbp3 C T 3: 142,272,099 (GRCm39) probably benign Het
Golga4 A G 9: 118,387,804 (GRCm39) D1642G possibly damaging Het
Hspa1a C T 17: 35,190,703 (GRCm39) V67M probably damaging Het
Hyls1 T C 9: 35,472,705 (GRCm39) D237G probably damaging Het
Kmt2e A G 5: 23,706,624 (GRCm39) N1396D probably benign Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Muc5b C T 7: 141,403,235 (GRCm39) T732M unknown Het
Mxd1 G T 6: 86,627,942 (GRCm39) Q199K probably benign Het
Or14a258 T A 7: 86,035,182 (GRCm39) T229S probably benign Het
Or4a78 T C 2: 89,497,357 (GRCm39) E291G probably damaging Het
Or5w18 T A 2: 87,633,031 (GRCm39) F95L probably benign Het
Or5w20 T A 2: 87,727,293 (GRCm39) probably null Het
Prps1l1 A T 12: 35,035,797 (GRCm39) H304L possibly damaging Het
Psmd2 A G 16: 20,474,392 (GRCm39) D316G probably benign Het
Rlf G A 4: 121,006,229 (GRCm39) T917I probably benign Het
Ryr3 T C 2: 112,466,953 (GRCm39) D4704G probably damaging Het
Scn1a T A 2: 66,104,332 (GRCm39) I1643F probably damaging Het
Vmn2r38 T C 7: 9,078,553 (GRCm39) K610E probably damaging Het
Zfc3h1 T C 10: 115,255,806 (GRCm39) F1486L probably benign Het
Other mutations in Lasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Lasp1 APN 11 97,727,016 (GRCm39) missense probably damaging 1.00
R0281:Lasp1 UTSW 11 97,697,677 (GRCm39) nonsense probably null
R2126:Lasp1 UTSW 11 97,726,960 (GRCm39) missense probably benign 0.34
R3906:Lasp1 UTSW 11 97,690,653 (GRCm39) missense probably damaging 1.00
R3908:Lasp1 UTSW 11 97,690,653 (GRCm39) missense probably damaging 1.00
R4908:Lasp1 UTSW 11 97,724,530 (GRCm39) critical splice donor site probably null
R5239:Lasp1 UTSW 11 97,690,686 (GRCm39) missense probably damaging 1.00
R6519:Lasp1 UTSW 11 97,706,383 (GRCm39) splice site probably null
R6576:Lasp1 UTSW 11 97,724,402 (GRCm39) missense probably damaging 1.00
R6629:Lasp1 UTSW 11 97,697,722 (GRCm39) nonsense probably null
R7001:Lasp1 UTSW 11 97,697,659 (GRCm39) missense probably damaging 1.00
R8063:Lasp1 UTSW 11 97,724,957 (GRCm39) missense probably benign 0.00
R8708:Lasp1 UTSW 11 97,697,709 (GRCm39) missense possibly damaging 0.67
R9710:Lasp1 UTSW 11 97,697,593 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCACTGTGTTTATTAGGGGAAGGAG -3'
(R):5'- TCCTAACCTCGATGCACAGAG -3'

Sequencing Primer
(F):5'- TTTATTAGGGGAAGGAGGGCGG -3'
(R):5'- TCGATGCACAGAGGCCAC -3'
Posted On 2015-04-17