Incidental Mutation 'R3909:Cacng1'
ID309313
Institutional Source Beutler Lab
Gene Symbol Cacng1
Ensembl Gene ENSMUSG00000020722
Gene Namecalcium channel, voltage-dependent, gamma subunit 1
Synonyms
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3909 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location107703218-107716522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107716292 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 34 (V34L)
Ref Sequence ENSEMBL: ENSMUSP00000021065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021065]
Predicted Effect probably benign
Transcript: ENSMUST00000021065
AA Change: V34L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021065
Gene: ENSMUSG00000020722
AA Change: V34L

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 6 200 6.3e-12 PFAM
Pfam:Claudin_2 17 202 2.6e-41 PFAM
Meta Mutation Damage Score 0.1692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is part of skeletal muscle 1,4-dihydropyridine-sensitive calcium channels and is an integral membrane protein that plays a role in excitation-contraction coupling. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for null mutations display abnormal muscle calcium currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Cacng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Cacng1 APN 11 107704369 missense probably benign
IGL02623:Cacng1 APN 11 107704319 missense probably damaging 1.00
R0920:Cacng1 UTSW 11 107705856 splice site probably benign
R2042:Cacng1 UTSW 11 107704308 missense probably damaging 1.00
R3906:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R3908:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R5247:Cacng1 UTSW 11 107716279 missense probably benign 0.45
R7158:Cacng1 UTSW 11 107703839 missense probably damaging 0.99
R7473:Cacng1 UTSW 11 107716192 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGTACCTCAGGCTGTTTCC -3'
(R):5'- TGCCACCATCTAGCTAGCTG -3'

Sequencing Primer
(F):5'- CTTATCTTGGAGTCTTGAAAGGAC -3'
(R):5'- ATCTAGCTAGCTGCCTGGGAG -3'
Posted On2015-04-17