Incidental Mutation 'R3909:Prps1l1'
ID309314
Institutional Source Beutler Lab
Gene Symbol Prps1l1
Ensembl Gene ENSMUSG00000092305
Gene Namephosphoribosyl pyrophosphate synthetase 1-like 1
Synonyms
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R3909 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location34984761-34986436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34985798 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 304 (H304L)
Ref Sequence ENSEMBL: ENSMUSP00000133931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134550]
Predicted Effect possibly damaging
Transcript: ENSMUST00000134550
AA Change: H304L

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133931
Gene: ENSMUSG00000092305
AA Change: H304L

DomainStartEndE-ValueType
Pfam:Pribosyltran_N 4 120 7.1e-49 PFAM
Pfam:Pribosyltran 139 261 1.5e-15 PFAM
Pfam:Pribosyl_synth 200 314 2.8e-39 PFAM
Meta Mutation Damage Score 0.4476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is specifically expressed in the testis, and encodes a protein that is highly homologous to the two subunits of phosphoribosylpyrophosphate synthetase encoded by human X-linked genes, PRPS1 and PRPS2. These enzymes convert pyrimidine, purine or pyridine bases to the corresponding ribonucleoside monophosphates. In vitro transcription/translation and site-directed mutagenesis studies indicate that translation of this mRNA initiates exclusively at a non-AUG (ACG) codon. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Prps1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Prps1l1 APN 12 34985378 missense probably benign 0.09
IGL01375:Prps1l1 APN 12 34985632 missense possibly damaging 0.78
R0379:Prps1l1 UTSW 12 34985078 missense probably benign 0.33
R2109:Prps1l1 UTSW 12 34985522 missense probably benign
R6129:Prps1l1 UTSW 12 34985330 missense probably damaging 0.99
R7284:Prps1l1 UTSW 12 34985318 missense possibly damaging 0.65
R7295:Prps1l1 UTSW 12 34985680 missense probably benign
R7374:Prps1l1 UTSW 12 34985425 missense possibly damaging 0.79
R8118:Prps1l1 UTSW 12 34985341 missense probably damaging 0.96
R8240:Prps1l1 UTSW 12 34985141 missense probably damaging 0.97
RF004:Prps1l1 UTSW 12 34985399 missense probably damaging 0.99
Z1177:Prps1l1 UTSW 12 34985264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACGCGGCGGACAAACTTC -3'
(R):5'- ACAATCCCCTATCTACTGAGGC -3'

Sequencing Primer
(F):5'- GGAGCTACCAGAGTTTATGCCATC -3'
(R):5'- TATCTACTGAGGCCACGGTG -3'
Posted On2015-04-17