Incidental Mutation 'R3909:Arid4b'
ID309315
Institutional Source Beutler Lab
Gene Symbol Arid4b
Ensembl Gene ENSMUSG00000039219
Gene NameAT rich interactive domain 4B (RBP1-like)
Synonyms6720480E17Rik, RBBP1L1, Rbp1l1, BRCAA1, SAP180, 6330417L24Rik
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3909 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14063232-14199603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14132484 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 108 (L108P)
Ref Sequence ENSEMBL: ENSMUSP00000118687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039538] [ENSMUST00000110533] [ENSMUST00000110534] [ENSMUST00000110536] [ENSMUST00000129488] [ENSMUST00000222928]
Predicted Effect probably damaging
Transcript: ENSMUST00000039538
AA Change: L108P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043889
Gene: ENSMUSG00000039219
AA Change: L108P

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110533
AA Change: L108P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106162
Gene: ENSMUSG00000039219
AA Change: L108P

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 9.5e-48 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110534
AA Change: L108P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106163
Gene: ENSMUSG00000039219
AA Change: L108P

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 168 263 4.1e-39 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
TUDOR 567 632 1.91e1 SMART
CHROMO 585 640 1.29e-1 SMART
low complexity region 708 722 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
low complexity region 802 815 N/A INTRINSIC
low complexity region 856 872 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
low complexity region 1041 1051 N/A INTRINSIC
low complexity region 1089 1103 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
coiled coil region 1232 1269 N/A INTRINSIC
low complexity region 1273 1291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110536
AA Change: L108P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106165
Gene: ENSMUSG00000039219
AA Change: L108P

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129488
AA Change: L108P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118687
Gene: ENSMUSG00000039219
AA Change: L108P

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 1.8e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 533 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222346
Predicted Effect probably damaging
Transcript: ENSMUST00000222928
AA Change: L108P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.5476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to retinoblastoma-binding protein-1. The encoded protein is a subunit of the histone deacetylase-dependant SIN3A transcriptional corepressor complex, which functions in diverse cellular processes including proliferation, differentiation, apoptosis, oncogenesis, and cell fate determination. The gene product is recognized by IgG antibody isolated from a breast cancer patient and appears to be a molecular marker associated with a broad range of human malignancies. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die pre-implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Arid4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Arid4b APN 13 14191134 unclassified probably benign
IGL00581:Arid4b APN 13 14160195 missense probably damaging 1.00
IGL00808:Arid4b APN 13 14136261 critical splice donor site probably null
IGL01150:Arid4b APN 13 14195374 nonsense probably null
IGL01570:Arid4b APN 13 14186809 unclassified probably benign
IGL01942:Arid4b APN 13 14136164 intron probably benign
IGL02031:Arid4b APN 13 14153412 splice site probably benign
IGL02183:Arid4b APN 13 14169990 missense possibly damaging 0.68
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0514:Arid4b UTSW 13 14184317 missense probably damaging 1.00
R0694:Arid4b UTSW 13 14187834 missense probably damaging 0.96
R0746:Arid4b UTSW 13 14143038 missense probably benign 0.01
R1624:Arid4b UTSW 13 14184394 missense probably damaging 0.99
R1625:Arid4b UTSW 13 14187114 missense probably damaging 0.99
R1812:Arid4b UTSW 13 14195429 missense probably damaging 1.00
R1891:Arid4b UTSW 13 14136236 missense possibly damaging 0.94
R1990:Arid4b UTSW 13 14132436 missense probably damaging 0.99
R2051:Arid4b UTSW 13 14187645 missense probably damaging 0.98
R2060:Arid4b UTSW 13 14195452 missense probably damaging 1.00
R2344:Arid4b UTSW 13 14153490 missense probably benign 0.26
R3605:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3606:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3844:Arid4b UTSW 13 14187060 missense probably damaging 0.99
R3938:Arid4b UTSW 13 14186928 missense probably benign 0.34
R4394:Arid4b UTSW 13 14154972 splice site probably null
R4466:Arid4b UTSW 13 14132510 missense probably damaging 1.00
R4530:Arid4b UTSW 13 14126455 missense probably damaging 0.98
R4537:Arid4b UTSW 13 14120161 nonsense probably null
R4829:Arid4b UTSW 13 14184438 missense probably benign 0.23
R4930:Arid4b UTSW 13 14187477 missense probably damaging 0.99
R4972:Arid4b UTSW 13 14160272 missense probably benign 0.07
R5119:Arid4b UTSW 13 14164281 missense probably benign 0.15
R5236:Arid4b UTSW 13 14126449 critical splice acceptor site probably null
R5304:Arid4b UTSW 13 14186929 missense probably benign 0.34
R5439:Arid4b UTSW 13 14187696 missense probably damaging 0.99
R5734:Arid4b UTSW 13 14160271 missense probably benign 0.09
R5950:Arid4b UTSW 13 14191264 splice site probably benign
R5951:Arid4b UTSW 13 14143063 missense possibly damaging 0.80
R6645:Arid4b UTSW 13 14120152 missense probably damaging 1.00
R6765:Arid4b UTSW 13 14187315 missense possibly damaging 0.84
R6804:Arid4b UTSW 13 14129207 missense probably benign 0.44
R7342:Arid4b UTSW 13 14136219 missense probably benign 0.03
R7354:Arid4b UTSW 13 14164870 missense probably benign 0.19
R7426:Arid4b UTSW 13 14181306 critical splice donor site probably null
R7863:Arid4b UTSW 13 14164149 missense probably benign 0.01
R8070:Arid4b UTSW 13 14136259 missense probably benign 0.32
R8076:Arid4b UTSW 13 14186950 missense probably benign 0.01
R8239:Arid4b UTSW 13 14170009 missense probably benign
R8303:Arid4b UTSW 13 14120223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGAAGTATGAACCGAATTCC -3'
(R):5'- CTGGATTGAAAGAGCAAAACCTCAC -3'

Sequencing Primer
(F):5'- ATTGGGACTATTTGCACTC -3'
(R):5'- TCTAATCCCAGTACTCAGGAGG -3'
Posted On2015-04-17