Incidental Mutation 'R3909:Hspa1a'
ID309318
Institutional Source Beutler Lab
Gene Symbol Hspa1a
Ensembl Gene ENSMUSG00000091971
Gene Nameheat shock protein 1A
SynonymsHsp70.3, Hsp70-3
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3909 (G1)
Quality Score192
Status Validated
Chromosome17
Chromosomal Location34969190-34972156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34971727 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 67 (V67M)
Ref Sequence ENSEMBL: ENSMUSP00000084586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000087328] [ENSMUST00000173680]
Predicted Effect probably benign
Transcript: ENSMUST00000007248
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087328
AA Change: V67M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084586
Gene: ENSMUSG00000091971
AA Change: V67M

DomainStartEndE-ValueType
Pfam:HSP70 6 612 1.3e-268 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173680
SMART Domains Protein: ENSMUSP00000133726
Gene: ENSMUSG00000092609

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
internal_repeat_1 91 102 5.9e-5 PROSPERO
internal_repeat_1 113 124 5.9e-5 PROSPERO
low complexity region 134 146 N/A INTRINSIC
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: At the cellular level, mice homozygous for a knock-out allele exhibit impaired thermotolerance and increased sensitivity to heat stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Hspa1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Hspa1a APN 17 34970524 missense probably damaging 1.00
IGL03380:Hspa1a APN 17 34970277 missense probably benign 0.17
R1983:Hspa1a UTSW 17 34970962 missense probably benign 0.01
R2117:Hspa1a UTSW 17 34970479 missense probably damaging 1.00
R3825:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3905:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3906:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3908:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R4301:Hspa1a UTSW 17 34970506 missense probably benign 0.11
R4453:Hspa1a UTSW 17 34970293 missense probably benign 0.32
R4610:Hspa1a UTSW 17 34971180 missense probably damaging 0.96
R4904:Hspa1a UTSW 17 34970451 missense probably damaging 1.00
R6253:Hspa1a UTSW 17 34970550 missense probably damaging 1.00
R6366:Hspa1a UTSW 17 34970524 missense probably damaging 1.00
R6478:Hspa1a UTSW 17 34970306 missense probably damaging 1.00
R6981:Hspa1a UTSW 17 34970291 splice site probably null
R8015:Hspa1a UTSW 17 34970649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCATGGACGAGATCTC -3'
(R):5'- TTCCATCCAGAGACAAGCG -3'

Sequencing Primer
(F):5'- GAGATCTCCTCCGGGAAGAAC -3'
(R):5'- TTCCAGAAGCAGAGCGC -3'
Posted On2015-04-17