Incidental Mutation 'R3909:Fbxl17'
ID309319
Institutional Source Beutler Lab
Gene Symbol Fbxl17
Ensembl Gene ENSMUSG00000023965
Gene NameF-box and leucine-rich repeat protein 17
Synonyms6330576B01Rik, Fbxo13, Fbx13, C130023C01Rik
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R3909 (G1)
Quality Score95
Status Validated
Chromosome17
Chromosomal Location63057452-63500017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63499807 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 71 (P71S)
Ref Sequence ENSEMBL: ENSMUSP00000024761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024761]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024761
AA Change: P71S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024761
Gene: ENSMUSG00000023965
AA Change: P71S

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
low complexity region 103 138 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
low complexity region 214 245 N/A INTRINSIC
low complexity region 246 270 N/A INTRINSIC
FBOX 324 365 3.1e-8 SMART
LRR 359 384 4.6e-1 SMART
LRR 385 410 2e-1 SMART
LRR 411 436 8.5e-2 SMART
LRR 437 462 6.9e-4 SMART
LRR 463 488 1.3e-5 SMART
LRR 489 514 5.2e-2 SMART
LRR 515 539 2.9e-3 SMART
LRR 540 564 2e-1 SMART
low complexity region 567 580 N/A INTRINSIC
LRR 591 615 8.4e-4 SMART
LRR 616 641 2.2e-1 SMART
LRR 642 667 6.3e-1 SMART
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL17, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Fbxl17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Fbxl17 APN 17 63385052 missense probably damaging 1.00
IGL02201:Fbxl17 APN 17 63499029 missense probably damaging 1.00
IGL02256:Fbxl17 APN 17 63499090 missense probably benign
IGL03408:Fbxl17 APN 17 63080546 nonsense probably null
R0268:Fbxl17 UTSW 17 63385067 splice site probably benign
R0269:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R0313:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0315:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0344:Fbxl17 UTSW 17 63385067 splice site probably benign
R0356:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0358:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0553:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0617:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R0629:Fbxl17 UTSW 17 63471414 missense probably damaging 1.00
R1597:Fbxl17 UTSW 17 63487818 missense probably damaging 1.00
R1666:Fbxl17 UTSW 17 63385065 splice site probably null
R3001:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3002:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3121:Fbxl17 UTSW 17 63471424 missense probably damaging 0.96
R4789:Fbxl17 UTSW 17 63487915 missense probably benign 0.40
R6606:Fbxl17 UTSW 17 63487788 missense probably damaging 0.97
R7153:Fbxl17 UTSW 17 63060351 missense probably benign 0.09
R7722:Fbxl17 UTSW 17 63356828 missense probably damaging 0.99
R7794:Fbxl17 UTSW 17 63356811 missense probably damaging 0.97
R7841:Fbxl17 UTSW 17 63487825 missense probably damaging 1.00
R8076:Fbxl17 UTSW 17 63060365 missense probably damaging 0.99
R8178:Fbxl17 UTSW 17 63487972 splice site probably null
R8338:Fbxl17 UTSW 17 63356758 missense possibly damaging 0.93
R8873:Fbxl17 UTSW 17 63384976 missense probably damaging 0.99
X0019:Fbxl17 UTSW 17 63060383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTTGCAAACCATCTCGAG -3'
(R):5'- ATATGGGCCACCTTCTCTCGAAG -3'

Sequencing Primer
(F):5'- AAACCATCTCGAGGGCCGTG -3'
(R):5'- TCTCGAAGGAGCCGCGTAAC -3'
Posted On2015-04-17