Incidental Mutation 'R0380:Itgal'
ID30932
Institutional Source Beutler Lab
Gene Symbol Itgal
Ensembl Gene ENSMUSG00000030830
Gene Nameintegrin alpha L
SynonymsLFA-1, Ly-21, Cd11a, Ly-15
MMRRC Submission 038586-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0380 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127296260-127335138 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 127310751 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 495 (Y495*)
Ref Sequence ENSEMBL: ENSMUSP00000131847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000118405] [ENSMUST00000120857] [ENSMUST00000170971]
Predicted Effect probably null
Transcript: ENSMUST00000106306
AA Change: Y495*
SMART Domains Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830
AA Change: Y495*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1043 1059 N/A INTRINSIC
transmembrane domain 1087 1109 N/A INTRINSIC
Pfam:Integrin_alpha 1110 1124 5.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117762
AA Change: Y495*
SMART Domains Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830
AA Change: Y495*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 5.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118405
AA Change: Y99*
SMART Domains Protein: ENSMUSP00000112591
Gene: ENSMUSG00000030830
AA Change: Y99*

DomainStartEndE-ValueType
Int_alpha 2 54 4.21e-3 SMART
Int_alpha 58 113 9.6e-7 SMART
Int_alpha 119 172 3.58e-15 SMART
Int_alpha 179 228 1.28e1 SMART
low complexity region 646 662 N/A INTRINSIC
transmembrane domain 690 712 N/A INTRINSIC
Pfam:Integrin_alpha 713 727 2.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120857
AA Change: Y495*
SMART Domains Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830
AA Change: Y495*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170971
AA Change: Y495*
SMART Domains Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830
AA Change: Y495*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 1.2e-6 PFAM
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,588,500 probably null Het
Abca14 A T 7: 120,278,480 I1073L probably benign Het
Adamts17 C T 7: 67,150,044 P1116L probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Ano4 A G 10: 88,978,813 I671T possibly damaging Het
Ap1g1 A G 8: 109,803,164 probably benign Het
Arhgap19 A G 19: 41,773,137 probably benign Het
Arhgap32 C T 9: 32,246,477 R129W probably damaging Het
Atp10b G T 11: 43,225,597 A924S probably damaging Het
Ccdc180 T A 4: 45,930,197 probably null Het
Cckbr A G 7: 105,434,991 T311A probably benign Het
Cr2 C T 1: 195,157,407 G947R probably damaging Het
Cyp2g1 T A 7: 26,814,295 probably benign Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
Doxl2 A G 6: 48,975,839 I233V probably benign Het
Dscam A G 16: 97,056,610 Y67H probably damaging Het
Dsg2 T A 18: 20,582,939 Y282* probably null Het
Epg5 T C 18: 77,960,841 L688P probably damaging Het
Esr2 T G 12: 76,123,291 E458A possibly damaging Het
Fat1 T C 8: 45,010,123 S1326P probably damaging Het
Flt1 A G 5: 147,588,572 S919P probably damaging Het
Gpr12 T A 5: 146,583,336 T259S probably damaging Het
Grm5 T A 7: 88,074,376 C625S possibly damaging Het
H2-Q1 C T 17: 35,323,078 H209Y probably damaging Het
Hcfc2 C A 10: 82,728,438 probably benign Het
Kbtbd3 T A 9: 4,330,545 Y306* probably null Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Kif1a T A 1: 93,056,031 probably null Het
Maml2 C T 9: 13,621,100 R537* probably null Het
Muc4 G A 16: 32,752,905 A928T probably benign Het
Nav3 A G 10: 109,758,879 probably benign Het
Neb A T 2: 52,232,202 M605K probably damaging Het
Olfr15 A T 16: 3,838,985 D4V probably benign Het
Pcdhb3 T G 18: 37,302,157 I392S possibly damaging Het
Prune2 A G 19: 17,124,007 T2292A probably damaging Het
Rbbp8nl A T 2: 180,281,719 M108K probably damaging Het
Rbm25 A G 12: 83,660,356 T259A probably benign Het
Recql C A 6: 142,369,430 R243L probably damaging Het
Rsf1 TGGCG TGGCGACGGCGGCG 7: 97,579,905 probably benign Het
Serpinb12 T C 1: 106,950,821 probably null Het
Slc16a14 T A 1: 84,929,530 I8F possibly damaging Het
Spef1 G T 2: 131,172,412 probably benign Het
Tas2r103 A G 6: 133,036,203 L300P probably damaging Het
Tas2r117 A T 6: 132,803,588 R230* probably null Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Thnsl2 A T 6: 71,141,330 L38Q probably damaging Het
Tmem171 G T 13: 98,692,027 T205K possibly damaging Het
Tmem232 A T 17: 65,256,448 L650Q probably benign Het
Tpr T A 1: 150,412,947 D518E probably benign Het
Tsen54 T C 11: 115,822,597 V442A probably damaging Het
Tshz3 A T 7: 36,771,300 I905F probably damaging Het
Vmn1r66 C T 7: 10,274,743 C121Y probably benign Het
Wdfy3 T C 5: 101,948,966 Q322R probably damaging Het
Wdr64 T C 1: 175,769,642 probably benign Het
Other mutations in Itgal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Itgal APN 7 127302011 missense probably damaging 0.99
IGL01300:Itgal APN 7 127314118 missense probably damaging 1.00
IGL01345:Itgal APN 7 127300956 missense possibly damaging 0.56
IGL01826:Itgal APN 7 127302146 missense probably benign 0.16
IGL02202:Itgal APN 7 127330179 nonsense probably null
IGL02212:Itgal APN 7 127300980 missense probably benign 0.00
IGL02513:Itgal APN 7 127328672 missense possibly damaging 0.78
IGL02608:Itgal APN 7 127310244 missense probably damaging 1.00
IGL02946:Itgal APN 7 127314368 missense probably damaging 0.99
sunglow UTSW 7 127328747 missense probably null 0.89
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0107:Itgal UTSW 7 127328559 splice site probably benign
R0331:Itgal UTSW 7 127306681 splice site probably null
R0350:Itgal UTSW 7 127322081 missense probably damaging 1.00
R0537:Itgal UTSW 7 127311273 missense possibly damaging 0.61
R0546:Itgal UTSW 7 127310314 missense probably benign 0.00
R0594:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1167:Itgal UTSW 7 127300939 missense probably damaging 1.00
R1377:Itgal UTSW 7 127321917 missense probably damaging 1.00
R1575:Itgal UTSW 7 127300888 critical splice acceptor site probably null
R1690:Itgal UTSW 7 127302117 missense possibly damaging 0.56
R1693:Itgal UTSW 7 127305281 missense probably damaging 1.00
R1702:Itgal UTSW 7 127305025 missense probably benign 0.00
R1720:Itgal UTSW 7 127306927 missense probably benign 0.00
R1774:Itgal UTSW 7 127309622 critical splice donor site probably null
R1824:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1878:Itgal UTSW 7 127310671 missense probably benign 0.44
R1951:Itgal UTSW 7 127330145 missense probably damaging 1.00
R2265:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2267:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2269:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2276:Itgal UTSW 7 127328747 missense probably null 0.89
R2570:Itgal UTSW 7 127314096 missense probably damaging 1.00
R3925:Itgal UTSW 7 127324537 splice site probably benign
R4225:Itgal UTSW 7 127305312 missense probably damaging 1.00
R4377:Itgal UTSW 7 127328281 missense probably benign 0.00
R4466:Itgal UTSW 7 127328512 missense possibly damaging 0.93
R4579:Itgal UTSW 7 127305294 missense possibly damaging 0.83
R4656:Itgal UTSW 7 127322553 missense probably damaging 1.00
R4771:Itgal UTSW 7 127328233 missense probably damaging 1.00
R5012:Itgal UTSW 7 127299630 critical splice donor site probably null
R5328:Itgal UTSW 7 127311675 critical splice donor site probably null
R5365:Itgal UTSW 7 127305350 missense probably damaging 0.98
R5579:Itgal UTSW 7 127306929 missense probably benign 0.10
R5849:Itgal UTSW 7 127317320 missense probably benign 0.27
R5955:Itgal UTSW 7 127304989 missense possibly damaging 0.82
R6254:Itgal UTSW 7 127325203 missense probably damaging 1.00
R6269:Itgal UTSW 7 127330217 missense probably null 1.00
R6520:Itgal UTSW 7 127330331 missense probably benign 0.01
R6541:Itgal UTSW 7 127311562 missense probably damaging 0.99
R7049:Itgal UTSW 7 127296401 unclassified probably benign
R7168:Itgal UTSW 7 127330213 missense probably benign
R7419:Itgal UTSW 7 127306875 missense probably benign 0.01
R7424:Itgal UTSW 7 127317365 missense probably benign 0.00
R7454:Itgal UTSW 7 127327764 missense probably benign 0.00
R7567:Itgal UTSW 7 127299788 missense probably benign 0.00
R7696:Itgal UTSW 7 127330184 missense probably damaging 1.00
R7977:Itgal UTSW 7 127328298 missense possibly damaging 0.88
R7987:Itgal UTSW 7 127328298 missense possibly damaging 0.88
R8118:Itgal UTSW 7 127311245 missense probably benign 0.08
R8297:Itgal UTSW 7 127330466 missense unknown
R8418:Itgal UTSW 7 127330282 missense probably benign 0.02
R8507:Itgal UTSW 7 127329435 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCCATTTCCCGACTCTGTCATAAGC -3'
(R):5'- TGGCACCCAGTCTTGCACAATAG -3'

Sequencing Primer
(F):5'- AGCTCAGGACTTGATTCTGC -3'
(R):5'- TAGACCACAACTATAAGCTGCTG -3'
Posted On2013-04-24