Incidental Mutation 'R3909:Ankrd12'
ID309320
Institutional Source Beutler Lab
Gene Symbol Ankrd12
Ensembl Gene ENSMUSG00000034647
Gene Nameankyrin repeat domain 12
Synonyms2900001A12Rik, GAC-1, ANCO-2
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R3909 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location65967501-66077089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65984005 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 1478 (P1478T)
Ref Sequence ENSEMBL: ENSMUSP00000039035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038116] [ENSMUST00000150766]
Predicted Effect probably benign
Transcript: ENSMUST00000038116
AA Change: P1478T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039035
Gene: ENSMUSG00000034647
AA Change: P1478T

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
ANK 184 213 8.78e-6 SMART
ANK 217 246 1.76e-5 SMART
ANK 250 279 7.64e-6 SMART
low complexity region 292 300 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
coiled coil region 459 497 N/A INTRINSIC
coiled coil region 639 676 N/A INTRINSIC
coiled coil region 725 752 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 999 1018 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
low complexity region 1182 1197 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146090
Predicted Effect probably benign
Transcript: ENSMUST00000150766
SMART Domains Protein: ENSMUSP00000114237
Gene: ENSMUSG00000034647

DomainStartEndE-ValueType
low complexity region 78 98 N/A INTRINSIC
ANK 161 190 8.78e-6 SMART
ANK 194 223 1.76e-5 SMART
ANK 227 256 7.64e-6 SMART
low complexity region 269 277 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ankyrin repeats-containing cofactor family. These proteins may inhibit the transcriptional activity of nuclear receptors through the recruitment of histone deacetylases. The encoded protein interacts with p160 coactivators and also represses transcription mediated by the coactivator alteration/deficiency in activation 3 (ADA3). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Ankrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ankrd12 APN 17 65986174 missense probably benign
IGL00555:Ankrd12 APN 17 65984976 missense probably benign 0.09
IGL00790:Ankrd12 APN 17 65984180 missense probably benign
IGL00808:Ankrd12 APN 17 65983965 missense probably benign 0.03
IGL01355:Ankrd12 APN 17 65970340 splice site probably benign
IGL01707:Ankrd12 APN 17 65984278 missense probably damaging 0.98
IGL02045:Ankrd12 APN 17 65986249 missense probably benign 0.17
IGL02125:Ankrd12 APN 17 65970144 utr 3 prime probably benign
IGL02292:Ankrd12 APN 17 66042587 missense probably damaging 0.99
IGL02376:Ankrd12 APN 17 66042529 intron probably benign
IGL02435:Ankrd12 APN 17 65987156 missense probably damaging 1.00
IGL02530:Ankrd12 APN 17 65984403 missense probably benign 0.20
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0094:Ankrd12 UTSW 17 65970176 missense probably damaging 1.00
R0195:Ankrd12 UTSW 17 66049948 splice site probably null
R0227:Ankrd12 UTSW 17 65987227 missense probably benign 0.00
R0363:Ankrd12 UTSW 17 65985681 missense probably damaging 1.00
R0366:Ankrd12 UTSW 17 65984506 missense possibly damaging 0.93
R0376:Ankrd12 UTSW 17 66053009 missense probably damaging 0.98
R0470:Ankrd12 UTSW 17 65986134 missense probably benign 0.00
R0480:Ankrd12 UTSW 17 66049828 missense possibly damaging 0.47
R0538:Ankrd12 UTSW 17 66049852 missense probably damaging 1.00
R0883:Ankrd12 UTSW 17 65985132 missense probably benign 0.19
R1181:Ankrd12 UTSW 17 66042574 missense probably benign 0.36
R1386:Ankrd12 UTSW 17 65983380 missense possibly damaging 0.94
R1476:Ankrd12 UTSW 17 65986305 missense probably damaging 0.99
R1574:Ankrd12 UTSW 17 65986274 missense probably benign 0.08
R1574:Ankrd12 UTSW 17 65986274 missense probably benign 0.08
R1602:Ankrd12 UTSW 17 65983688 nonsense probably null
R1728:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1729:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1784:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1795:Ankrd12 UTSW 17 65986227 missense possibly damaging 0.89
R1901:Ankrd12 UTSW 17 65986703 missense possibly damaging 0.58
R1929:Ankrd12 UTSW 17 65986686 missense possibly damaging 0.55
R1952:Ankrd12 UTSW 17 66031571 missense probably damaging 0.98
R1997:Ankrd12 UTSW 17 65984884 missense probably damaging 1.00
R2207:Ankrd12 UTSW 17 66031574 splice site probably null
R3612:Ankrd12 UTSW 17 65983547 missense probably benign 0.01
R3768:Ankrd12 UTSW 17 65985720 missense probably benign
R3945:Ankrd12 UTSW 17 65976103 missense probably damaging 1.00
R4176:Ankrd12 UTSW 17 66027366 missense probably damaging 1.00
R4461:Ankrd12 UTSW 17 65985937 splice site probably null
R4628:Ankrd12 UTSW 17 65985994 missense probably benign
R4726:Ankrd12 UTSW 17 65970324 missense probably damaging 1.00
R4785:Ankrd12 UTSW 17 65982999 missense probably damaging 1.00
R4828:Ankrd12 UTSW 17 65984637 missense probably damaging 0.99
R4847:Ankrd12 UTSW 17 66024092 missense probably benign 0.14
R4858:Ankrd12 UTSW 17 66031433 missense probably damaging 1.00
R5344:Ankrd12 UTSW 17 66049848 missense probably damaging 1.00
R5749:Ankrd12 UTSW 17 65986096 missense probably benign 0.02
R7132:Ankrd12 UTSW 17 65983247 missense probably benign
R7205:Ankrd12 UTSW 17 65985165 missense probably damaging 1.00
R7379:Ankrd12 UTSW 17 65985247 nonsense probably null
R7569:Ankrd12 UTSW 17 65982905 missense probably damaging 1.00
R7570:Ankrd12 UTSW 17 65985360 missense probably benign
R7783:Ankrd12 UTSW 17 66027250 critical splice donor site probably null
R7790:Ankrd12 UTSW 17 65984230 missense possibly damaging 0.71
R7808:Ankrd12 UTSW 17 65985653 missense possibly damaging 0.94
R7834:Ankrd12 UTSW 17 65987352 missense probably damaging 1.00
R7896:Ankrd12 UTSW 17 65985685 nonsense probably null
R7985:Ankrd12 UTSW 17 65984196 missense probably benign 0.00
R8251:Ankrd12 UTSW 17 65984559 missense possibly damaging 0.94
R8304:Ankrd12 UTSW 17 65984547 missense possibly damaging 0.86
R8379:Ankrd12 UTSW 17 65983944 missense probably benign 0.01
R8441:Ankrd12 UTSW 17 66042551 missense probably benign 0.21
R8485:Ankrd12 UTSW 17 65983716 missense probably benign 0.00
R8507:Ankrd12 UTSW 17 65986909 nonsense probably null
R8677:Ankrd12 UTSW 17 66024214 missense probably damaging 1.00
R8790:Ankrd12 UTSW 17 65983158 missense possibly damaging 0.89
R8888:Ankrd12 UTSW 17 66031573 critical splice acceptor site probably null
Z1176:Ankrd12 UTSW 17 65970338 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCAAAGCTTGGGAGTGC -3'
(R):5'- CTGATCAAGATTCCTCTGCTCAG -3'

Sequencing Primer
(F):5'- CTTGCACAGTGCTTTCAGAGTAAGC -3'
(R):5'- AACTCATGTGCTCAGGAC -3'
Posted On2015-04-17