Incidental Mutation 'R3910:Ugt1a8'
ID309324
Institutional Source Beutler Lab
Gene Symbol Ugt1a8
Ensembl Gene ENSMUSG00000089675
Gene NameUDP glucuronosyltransferase 1 family, polypeptide A8
SynonymsOTTMUSG00000020811, A116
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location88087813-88219004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88088048 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 61 (E61G)
Ref Sequence ENSEMBL: ENSMUSP00000108764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073772] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000138182] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113139
AA Change: E61G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675
AA Change: E61G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Meta Mutation Damage Score 0.5717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Ugt1a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ugt1a8 APN 1 88087895 missense probably benign 0.01
IGL01404:Ugt1a8 APN 1 88087895 missense probably benign 0.01
IGL02838:Ugt1a8 APN 1 88088677 missense probably benign 0.37
R0220:Ugt1a8 UTSW 1 88088335 missense probably benign
R0504:Ugt1a8 UTSW 1 88088357 missense probably damaging 1.00
R2087:Ugt1a8 UTSW 1 88088273 missense probably damaging 1.00
R4297:Ugt1a8 UTSW 1 88088104 missense probably benign 0.00
R5213:Ugt1a8 UTSW 1 88088123 nonsense probably null
R7048:Ugt1a8 UTSW 1 88088302 missense probably benign 0.17
R7592:Ugt1a8 UTSW 1 88088182 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACAGTCCCAGCCCATGTATTC -3'
(R):5'- AGTACTTGGAAGAAACCTTTGCC -3'

Sequencing Primer
(F):5'- AGCCCATGTATTCTCCTGGG -3'
(R):5'- TGGAAGAAACCTTTGCCTGAATGC -3'
Posted On2015-04-17