Mutagenetix > Incidental Mutations

Incidental Mutation 'R3910:Kirrel'

309329

Institutional Source

Beutler Lab

Gene Symbol

Kirrel

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

Kirrel1, 6720469N11Rik, Neph1

MMRRC Submission

040815-MU

Accession Numbers

Genbank: NM_130867; MGI: 1891396

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3910 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87078593-87174747 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87089151 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 380 (M380I)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

Predicted Effect

probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.0922

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	A	T	5: 24,545,442		probably benign	Het
9030624J02Rik	A	G	7: 118,746,390	T49A	possibly damaging	Het
Bod1l	T	C	5: 41,817,098	E2291G	probably damaging	Het
Cchcr1	T	C	17: 35,525,336	V341A	probably damaging	Het
Dsg1c	T	C	18: 20,266,196	V119A	possibly damaging	Het
Fap	A	G	2: 62,556,104	S58P	probably damaging	Het
Flnc	A	T	6: 29,459,427	T2509S	probably damaging	Het
Fnip2	A	T	3: 79,479,505	D971E	possibly damaging	Het
Gab2	A	G	7: 97,299,073	Y290C	probably damaging	Het
Gm7104	C	T	12: 88,284,594		noncoding transcript	Het
Ints10	T	A	8: 68,813,620	S478T	probably damaging	Het
Krt90	G	A	15: 101,562,783	R15W	probably damaging	Het
Lgr5	A	G	10: 115,587,463	S11P	possibly damaging	Het
Mycn	T	A	12: 12,937,280	N372I	probably damaging	Het
Olfr459	A	G	6: 41,772,149	V50A	probably benign	Het
Olfr700	A	T	7: 106,805,865	V199D	probably damaging	Het
Paxbp1	T	A	16: 91,042,681	E117V	probably damaging	Het
Phc2	T	C	4: 128,743,558		probably null	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Rev3l	A	G	10: 39,820,556	I521M	probably damaging	Het
Robo3	A	T	9: 37,419,295	Y1002N	probably damaging	Het
Svep1	A	T	4: 58,145,156		probably null	Het
Thsd7a	A	G	6: 12,331,549	V1342A	probably damaging	Het
Tmtc3	A	C	10: 100,449,026	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,256,182		probably benign	Het
Trim30a	A	G	7: 104,411,141	V476A	probably damaging	Het
Ugt1a8	A	G	1: 88,088,048	E61G	possibly damaging	Het
Vmn1r75	A	T	7: 11,880,830	N163I	possibly damaging	Het
Zfp119a	G	A	17: 55,866,520	L108F	probably benign	Het

Other mutations in Kirrel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel	APN	3	87089875	missense	probably benign	0.22
IGL01865:Kirrel	APN	3	87086424	missense	probably damaging	1.00
IGL01875:Kirrel	APN	3	87095730	missense	probably damaging	1.00
IGL02337:Kirrel	APN	3	87089212	missense	possibly damaging	0.64
IGL02724:Kirrel	APN	3	87090473	nonsense	probably null
IGL02825:Kirrel	APN	3	87089288	splice site	probably benign
IGL02826:Kirrel	APN	3	87088485	missense	probably damaging	1.00
IGL03102:Kirrel	APN	3	87083500	missense	probably damaging	0.98
D4043:Kirrel	UTSW	3	87083203	missense	probably benign	0.02
R0360:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0364:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0421:Kirrel	UTSW	3	87083607	missense	probably damaging	0.99
R0503:Kirrel	UTSW	3	87097802	missense	probably benign	0.20
R1112:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1116:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1144:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1190:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1226:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1501:Kirrel	UTSW	3	87090472	missense	probably benign	0.02
R1538:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1546:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1628:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1630:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1631:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1664:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1671:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1695:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1769:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1807:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1808:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1840:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1876:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1995:Kirrel	UTSW	3	87095786	missense	possibly damaging	0.88
R2014:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2086:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2108:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2354:Kirrel	UTSW	3	87088485	missense	probably damaging	0.98
R2407:Kirrel	UTSW	3	87084843	missense	probably benign	0.03
R2904:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2905:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2958:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2959:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2960:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2961:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3026:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3028:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3034:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R3149:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3195:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3196:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3499:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3699:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3720:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3721:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3788:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3793:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3876:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3877:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3901:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3911:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3912:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3913:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3930:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3931:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4022:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4067:Kirrel	UTSW	3	87088467	nonsense	probably null
R4077:Kirrel	UTSW	3	87085080	critical splice donor site	probably null
R4198:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4328:Kirrel	UTSW	3	87084774	intron	probably benign
R4355:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4363:Kirrel	UTSW	3	87090485	nonsense	probably null
R4378:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4386:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4460:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4468:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4469:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4650:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4652:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4734:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4748:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4749:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R5304:Kirrel	UTSW	3	87089595	missense	probably benign	0.02
R5534:Kirrel	UTSW	3	87090518	missense	probably damaging	1.00
R5604:Kirrel	UTSW	3	87089155	missense	possibly damaging	0.69
R7199:Kirrel	UTSW	3	87083388	missense	probably benign	0.02
R7221:Kirrel	UTSW	3	87086397	nonsense	probably null
R7284:Kirrel	UTSW	3	87083387	missense	probably benign	0.02
R7332:Kirrel	UTSW	3	87088398	missense	probably benign	0.14
R7369:Kirrel	UTSW	3	87141084	missense	probably benign	0.20
R7371:Kirrel	UTSW	3	87088422	missense	probably benign	0.44
R7508:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R7566:Kirrel	UTSW	3	87088484	missense	probably damaging	1.00
R7567:Kirrel	UTSW	3	87095681	missense	probably damaging	0.99
R7621:Kirrel	UTSW	3	87088221	missense	possibly damaging	0.70
R8030:Kirrel	UTSW	3	87097775	missense	probably damaging	1.00
R8141:Kirrel	UTSW	3	87086428	nonsense	probably null
R8261:Kirrel	UTSW	3	87088002	intron	probably benign
R8477:Kirrel	UTSW	3	87084831	missense	possibly damaging	0.71
R8512:Kirrel	UTSW	3	87088227	missense	probably benign	0.00
Z1177:Kirrel	UTSW	3	87083875	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACCCTGAGTTCTATGCAAGTC -3'
(R):5'- GCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'

Posted On

2015-04-17