Incidental Mutation 'R3910:Olfr459'
ID309337
Institutional Source Beutler Lab
Gene Symbol Olfr459
Ensembl Gene ENSMUSG00000045479
Gene Nameolfactory receptor 459
SynonymsGA_x6K02T2P3E9-5780974-5781915, MOR120-1
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41768770-41775177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41772149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 50 (V50A)
Ref Sequence ENSEMBL: ENSMUSP00000149928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050412] [ENSMUST00000214752] [ENSMUST00000214976]
Predicted Effect probably benign
Transcript: ENSMUST00000050412
AA Change: V50A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061622
Gene: ENSMUSG00000045479
AA Change: V50A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.9e-46 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.7e-6 PFAM
Pfam:7tm_1 40 290 6.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203430
AA Change: V50A
SMART Domains Protein: ENSMUSP00000145036
Gene: ENSMUSG00000045479
AA Change: V50A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.9e-46 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.7e-6 PFAM
Pfam:7tm_1 40 290 6.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214752
AA Change: V50A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000214976
AA Change: V50A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1353 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Olfr459
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Olfr459 APN 6 41772113 missense probably damaging 1.00
IGL01460:Olfr459 APN 6 41772282 missense probably benign 0.12
IGL02465:Olfr459 APN 6 41771556 missense probably damaging 1.00
R0352:Olfr459 UTSW 6 41772124 missense probably damaging 0.99
R0443:Olfr459 UTSW 6 41771895 missense possibly damaging 0.75
R0480:Olfr459 UTSW 6 41772264 missense probably benign 0.01
R1491:Olfr459 UTSW 6 41771522 missense possibly damaging 0.95
R1495:Olfr459 UTSW 6 41771903 missense probably damaging 1.00
R2103:Olfr459 UTSW 6 41772005 missense probably benign 0.36
R3688:Olfr459 UTSW 6 41772226 nonsense probably null
R4709:Olfr459 UTSW 6 41771508 missense probably benign 0.06
R4710:Olfr459 UTSW 6 41771508 missense probably benign 0.06
R4960:Olfr459 UTSW 6 41772069 missense probably damaging 0.97
R5162:Olfr459 UTSW 6 41771772 missense possibly damaging 0.80
R5236:Olfr459 UTSW 6 41772111 missense probably benign 0.00
R5441:Olfr459 UTSW 6 41771848 missense probably benign 0.00
R7171:Olfr459 UTSW 6 41772027 missense probably benign 0.09
R7400:Olfr459 UTSW 6 41771744 missense probably damaging 1.00
R8115:Olfr459 UTSW 6 41771538 missense probably benign 0.00
R8346:Olfr459 UTSW 6 41772123 missense probably damaging 1.00
R8363:Olfr459 UTSW 6 41771750 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCAAGCACTGCAAACTCTG -3'
(R):5'- GAAGGATCTGTTTGATGCAGACC -3'

Sequencing Primer
(F):5'- TGCAAACTCTGTGGTCCCTAGAG -3'
(R):5'- TGATGCAGACCTACAACTTGG -3'
Posted On2015-04-17