Mutagenetix > Incidental Mutations

Incidental Mutation 'R3910:Olfr459'

309337

Institutional Source

Beutler Lab

Gene Symbol

Olfr459

Ensembl Gene

ENSMUSG00000045479

Gene Name

olfactory receptor 459

Synonyms

GA_x6K02T2P3E9-5780974-5781915, MOR120-1

MMRRC Submission

040815-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.284) question?

Stock #

R3910 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41768770-41775177 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41772149 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 50 (V50A)

Ref Sequence

ENSEMBL: ENSMUSP00000149928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050412] [ENSMUST00000214752] [ENSMUST00000214976]

Predicted Effect

probably benign
Transcript: ENSMUST00000050412
AA Change: V50A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000061622
Gene: ENSMUSG00000045479
AA Change: V50A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	307	7.9e-46	PFAM
Pfam:7TM_GPCR_Srsx	34	304	1.7e-6	PFAM
Pfam:7tm_1	40	290	6.2e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203430
AA Change: V50A

SMART Domains

Protein: ENSMUSP00000145036
Gene: ENSMUSG00000045479
AA Change: V50A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	307	7.9e-46	PFAM
Pfam:7TM_GPCR_Srsx	34	304	1.7e-6	PFAM
Pfam:7tm_1	40	290	6.2e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214752
AA Change: V50A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000214976
AA Change: V50A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.1353

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	A	T	5: 24,545,442		probably benign	Het
9030624J02Rik	A	G	7: 118,746,390	T49A	possibly damaging	Het
Bod1l	T	C	5: 41,817,098	E2291G	probably damaging	Het
Cchcr1	T	C	17: 35,525,336	V341A	probably damaging	Het
Dsg1c	T	C	18: 20,266,196	V119A	possibly damaging	Het
Fap	A	G	2: 62,556,104	S58P	probably damaging	Het
Flnc	A	T	6: 29,459,427	T2509S	probably damaging	Het
Fnip2	A	T	3: 79,479,505	D971E	possibly damaging	Het
Gab2	A	G	7: 97,299,073	Y290C	probably damaging	Het
Gm7104	C	T	12: 88,284,594		noncoding transcript	Het
Ints10	T	A	8: 68,813,620	S478T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt90	G	A	15: 101,562,783	R15W	probably damaging	Het
Lgr5	A	G	10: 115,587,463	S11P	possibly damaging	Het
Mycn	T	A	12: 12,937,280	N372I	probably damaging	Het
Olfr700	A	T	7: 106,805,865	V199D	probably damaging	Het
Paxbp1	T	A	16: 91,042,681	E117V	probably damaging	Het
Phc2	T	C	4: 128,743,558		probably null	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Rev3l	A	G	10: 39,820,556	I521M	probably damaging	Het
Robo3	A	T	9: 37,419,295	Y1002N	probably damaging	Het
Svep1	A	T	4: 58,145,156		probably null	Het
Thsd7a	A	G	6: 12,331,549	V1342A	probably damaging	Het
Tmtc3	A	C	10: 100,449,026	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,256,182		probably benign	Het
Trim30a	A	G	7: 104,411,141	V476A	probably damaging	Het
Ugt1a8	A	G	1: 88,088,048	E61G	possibly damaging	Het
Vmn1r75	A	T	7: 11,880,830	N163I	possibly damaging	Het
Zfp119a	G	A	17: 55,866,520	L108F	probably benign	Het

Other mutations in Olfr459

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Olfr459	APN	6	41772113	missense	probably damaging	1.00
IGL01460:Olfr459	APN	6	41772282	missense	probably benign	0.12
IGL02465:Olfr459	APN	6	41771556	missense	probably damaging	1.00
R0352:Olfr459	UTSW	6	41772124	missense	probably damaging	0.99
R0443:Olfr459	UTSW	6	41771895	missense	possibly damaging	0.75
R0480:Olfr459	UTSW	6	41772264	missense	probably benign	0.01
R1491:Olfr459	UTSW	6	41771522	missense	possibly damaging	0.95
R1495:Olfr459	UTSW	6	41771903	missense	probably damaging	1.00
R2103:Olfr459	UTSW	6	41772005	missense	probably benign	0.36
R3688:Olfr459	UTSW	6	41772226	nonsense	probably null
R4709:Olfr459	UTSW	6	41771508	missense	probably benign	0.06
R4710:Olfr459	UTSW	6	41771508	missense	probably benign	0.06
R4960:Olfr459	UTSW	6	41772069	missense	probably damaging	0.97
R5162:Olfr459	UTSW	6	41771772	missense	possibly damaging	0.80
R5236:Olfr459	UTSW	6	41772111	missense	probably benign	0.00
R5441:Olfr459	UTSW	6	41771848	missense	probably benign	0.00
R7171:Olfr459	UTSW	6	41772027	missense	probably benign	0.09
R7400:Olfr459	UTSW	6	41771744	missense	probably damaging	1.00
R8115:Olfr459	UTSW	6	41771538	missense	probably benign	0.00
R8346:Olfr459	UTSW	6	41772123	missense	probably damaging	1.00
R8363:Olfr459	UTSW	6	41771750	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TCCAAGCACTGCAAACTCTG -3'
(R):5'- GAAGGATCTGTTTGATGCAGACC -3'

Sequencing Primer
(F):5'- TGCAAACTCTGTGGTCCCTAGAG -3'
(R):5'- TGATGCAGACCTACAACTTGG -3'

Posted On

2015-04-17