Incidental Mutation 'R3910:Gab2'
ID309339
Institutional Source Beutler Lab
Gene Symbol Gab2
Ensembl Gene ENSMUSG00000004508
Gene Namegrowth factor receptor bound protein 2-associated protein 2
SynonymsD130058I17Rik, p97
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.504) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97081586-97308946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97299073 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 290 (Y290C)
Ref Sequence ENSEMBL: ENSMUSP00000146200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004622] [ENSMUST00000206791]
Predicted Effect probably damaging
Transcript: ENSMUST00000004622
AA Change: Y290C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004622
Gene: ENSMUSG00000004508
AA Change: Y290C

DomainStartEndE-ValueType
PH 9 121 1.07e-22 SMART
Blast:PH 268 314 4e-11 BLAST
low complexity region 348 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000206791
AA Change: Y290C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8451 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein (GAB) gene family. These proteins contain pleckstrin homology (PH) domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. They act as adapters for transmitting various signals in response to stimuli through cytokine and growth factor receptors, and T- and B-cell antigen receptors. The protein encoded by this gene is the principal activator of phosphatidylinositol-3 kinase in response to activation of the high affinity IgE receptor. Two alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in passive cutaneous and systemic anaphylaxis, Fc gamma receptor-mediated phagocytosis, and mast cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Gab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Gab2 APN 7 97302443 missense possibly damaging 0.91
IGL00325:Gab2 APN 7 97299258 missense probably damaging 1.00
IGL01832:Gab2 APN 7 97304238 missense probably damaging 1.00
IGL01955:Gab2 APN 7 97304223 missense probably damaging 1.00
IGL02664:Gab2 APN 7 97304182 missense probably damaging 1.00
R0105:Gab2 UTSW 7 97299072 missense probably damaging 1.00
R0105:Gab2 UTSW 7 97299072 missense probably damaging 1.00
R0243:Gab2 UTSW 7 97299241 missense probably damaging 0.96
R0827:Gab2 UTSW 7 97300332 missense probably damaging 1.00
R1696:Gab2 UTSW 7 97223633 missense probably damaging 1.00
R1872:Gab2 UTSW 7 97299043 missense probably damaging 0.99
R2973:Gab2 UTSW 7 97223552 missense probably benign 0.07
R3195:Gab2 UTSW 7 97272029 missense probably benign
R3827:Gab2 UTSW 7 97223741 missense probably damaging 1.00
R3911:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R3912:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R4604:Gab2 UTSW 7 97304213 missense probably damaging 0.99
R5506:Gab2 UTSW 7 97303113 missense probably damaging 1.00
R5655:Gab2 UTSW 7 97298892 missense probably benign
R6299:Gab2 UTSW 7 97081859 missense probably benign 0.00
R7038:Gab2 UTSW 7 97303083 missense probably damaging 1.00
R7313:Gab2 UTSW 7 97081798 start gained probably benign
R7586:Gab2 UTSW 7 97301438 missense probably damaging 1.00
R7729:Gab2 UTSW 7 97301426 missense probably damaging 1.00
R8434:Gab2 UTSW 7 97299130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGACACTGTATCAACGGC -3'
(R):5'- CCCCATTGAGGTGTTTCTGC -3'

Sequencing Primer
(F):5'- ACTGTATCAACGGCGTCGGAG -3'
(R):5'- CCATTGAGGTGTTTCTGCCTGAC -3'
Posted On2015-04-17