Incidental Mutation 'R3910:Trim30a'
ID309340
Institutional Source Beutler Lab
Gene Symbol Trim30a
Ensembl Gene ENSMUSG00000030921
Gene Nametripartite motif-containing 30A
SynonymsRpt-1, Rpt1, Trim30
MMRRC Submission 040815-MU
Accession Numbers

Ncbi RefSeq: NM_009099.2; MGI:98178

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104409025-104465193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104411141 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 476 (V476A)
Ref Sequence ENSEMBL: ENSMUSP00000076189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076922]
PDB Structure
Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000076922
AA Change: V476A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076189
Gene: ENSMUSG00000030921
AA Change: V476A

DomainStartEndE-ValueType
RING 15 58 2.88e-10 SMART
BBOX 91 132 3.52e-14 SMART
coiled coil region 173 241 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
Pfam:SPRY 349 493 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211270
Meta Mutation Damage Score 0.4097 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Homozygous null mice show increased CD4/CD8 ratio with age, an abnormal CD4+ T cell response upon TCR activation, and reduced effector function of CD4+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Trim30a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02677:Trim30a APN 7 104435913 missense probably damaging 1.00
IGL02944:Trim30a APN 7 104435777 missense probably benign 0.19
IGL03135:Trim30a APN 7 104411141 missense probably damaging 0.98
BB009:Trim30a UTSW 7 104429338 missense probably benign 0.00
BB019:Trim30a UTSW 7 104429338 missense probably benign 0.00
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0682:Trim30a UTSW 7 104429182 missense probably damaging 1.00
R1773:Trim30a UTSW 7 104435901 missense probably damaging 1.00
R1862:Trim30a UTSW 7 104411198 missense probably damaging 0.99
R1872:Trim30a UTSW 7 104429210 missense probably benign 0.01
R1986:Trim30a UTSW 7 104411465 missense probably damaging 1.00
R1991:Trim30a UTSW 7 104430230 splice site probably benign
R2259:Trim30a UTSW 7 104411504 missense probably damaging 1.00
R2571:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
R3719:Trim30a UTSW 7 104411163 missense probably benign 0.00
R3880:Trim30a UTSW 7 104411189 missense probably benign
R3911:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R3912:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R4343:Trim30a UTSW 7 104435592 missense probably benign 0.00
R4572:Trim30a UTSW 7 104411188 nonsense probably null
R4587:Trim30a UTSW 7 104435644 nonsense probably null
R4997:Trim30a UTSW 7 104411620 missense probably benign 0.21
R5051:Trim30a UTSW 7 104411706 intron probably benign
R5414:Trim30a UTSW 7 104411141 missense probably damaging 1.00
R5613:Trim30a UTSW 7 104430182 missense probably damaging 1.00
R5930:Trim30a UTSW 7 104421450 missense possibly damaging 0.95
R6262:Trim30a UTSW 7 104411534 missense probably benign 0.00
R7133:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
R7222:Trim30a UTSW 7 104421432 splice site probably null
R7739:Trim30a UTSW 7 104430179 missense possibly damaging 0.50
R7797:Trim30a UTSW 7 104411200 missense possibly damaging 0.86
R7803:Trim30a UTSW 7 104411397 nonsense probably null
R7836:Trim30a UTSW 7 104435595 missense probably benign 0.06
R7908:Trim30a UTSW 7 104421449 missense probably benign 0.01
R7932:Trim30a UTSW 7 104429338 missense probably benign 0.00
R7934:Trim30a UTSW 7 104412241 missense probably damaging 1.00
R8240:Trim30a UTSW 7 104421456 missense probably benign 0.01
R8405:Trim30a UTSW 7 104411542 nonsense probably null
X0012:Trim30a UTSW 7 104430203 nonsense probably null
Z1088:Trim30a UTSW 7 104435654 missense probably damaging 1.00
Z1177:Trim30a UTSW 7 104411463 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGCATAAGATACACCAGACATGGG -3'
(R):5'- AGCCTAAATGTGGCTACTGGG -3'

Sequencing Primer
(F):5'- CAGACATGGGGGCACTG -3'
(R):5'- GAATCCGTCTGTATACAAGGCCTTTG -3'
Posted On2015-04-17