Mutagenetix > Incidental Mutations

Incidental Mutation 'R3910:Trim30a'

309340

Institutional Source

Beutler Lab

Gene Symbol

Trim30a

Ensembl Gene

ENSMUSG00000030921

Gene Name

tripartite motif-containing 30A

Synonyms

Rpt-1, Rpt1, Trim30

MMRRC Submission

040815-MU

Accession Numbers

Ncbi RefSeq: NM_009099.2; MGI:98178

Is this an essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R3910 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104409025-104465193 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104411141 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 476 (V476A)

Ref Sequence

ENSEMBL: ENSMUSP00000076189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076922]

PDB Structure

Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000076922
AA Change: V476A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076189
Gene: ENSMUSG00000030921
AA Change: V476A

Domain	Start	End	E-Value	Type
RING	15	58	2.88e-10	SMART
BBOX	91	132	3.52e-14	SMART
coiled coil region	173	241	N/A	INTRINSIC
low complexity region	255	265	N/A	INTRINSIC
Pfam:SPRY	349	493	1.6e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125762

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211270

Meta Mutation Damage Score

0.4097

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

PHENOTYPE: Homozygous null mice show increased CD4/CD8 ratio with age, an abnormal CD4+ T cell response upon TCR activation, and reduced effector function of CD4+ T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	A	T	5: 24,545,442		probably benign	Het
9030624J02Rik	A	G	7: 118,746,390	T49A	possibly damaging	Het
Bod1l	T	C	5: 41,817,098	E2291G	probably damaging	Het
Cchcr1	T	C	17: 35,525,336	V341A	probably damaging	Het
Dsg1c	T	C	18: 20,266,196	V119A	possibly damaging	Het
Fap	A	G	2: 62,556,104	S58P	probably damaging	Het
Flnc	A	T	6: 29,459,427	T2509S	probably damaging	Het
Fnip2	A	T	3: 79,479,505	D971E	possibly damaging	Het
Gab2	A	G	7: 97,299,073	Y290C	probably damaging	Het
Gm7104	C	T	12: 88,284,594		noncoding transcript	Het
Ints10	T	A	8: 68,813,620	S478T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt90	G	A	15: 101,562,783	R15W	probably damaging	Het
Lgr5	A	G	10: 115,587,463	S11P	possibly damaging	Het
Mycn	T	A	12: 12,937,280	N372I	probably damaging	Het
Olfr459	A	G	6: 41,772,149	V50A	probably benign	Het
Olfr700	A	T	7: 106,805,865	V199D	probably damaging	Het
Paxbp1	T	A	16: 91,042,681	E117V	probably damaging	Het
Phc2	T	C	4: 128,743,558		probably null	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Rev3l	A	G	10: 39,820,556	I521M	probably damaging	Het
Robo3	A	T	9: 37,419,295	Y1002N	probably damaging	Het
Svep1	A	T	4: 58,145,156		probably null	Het
Thsd7a	A	G	6: 12,331,549	V1342A	probably damaging	Het
Tmtc3	A	C	10: 100,449,026	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,256,182		probably benign	Het
Ugt1a8	A	G	1: 88,088,048	E61G	possibly damaging	Het
Vmn1r75	A	T	7: 11,880,830	N163I	possibly damaging	Het
Zfp119a	G	A	17: 55,866,520	L108F	probably benign	Het

Other mutations in Trim30a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02677:Trim30a	APN	7	104435913	missense	probably damaging	1.00
IGL02944:Trim30a	APN	7	104435777	missense	probably benign	0.19
IGL03135:Trim30a	APN	7	104411141	missense	probably damaging	0.98
BB009:Trim30a	UTSW	7	104429338	missense	probably benign	0.00
BB019:Trim30a	UTSW	7	104429338	missense	probably benign	0.00
R0049:Trim30a	UTSW	7	104429352	critical splice acceptor site	probably null
R0049:Trim30a	UTSW	7	104429352	critical splice acceptor site	probably null
R0682:Trim30a	UTSW	7	104429182	missense	probably damaging	1.00
R1773:Trim30a	UTSW	7	104435901	missense	probably damaging	1.00
R1862:Trim30a	UTSW	7	104411198	missense	probably damaging	0.99
R1872:Trim30a	UTSW	7	104429210	missense	probably benign	0.01
R1986:Trim30a	UTSW	7	104411465	missense	probably damaging	1.00
R1991:Trim30a	UTSW	7	104430230	splice site	probably benign
R2259:Trim30a	UTSW	7	104411504	missense	probably damaging	1.00
R2571:Trim30a	UTSW	7	104429326	missense	possibly damaging	0.93
R3719:Trim30a	UTSW	7	104411163	missense	probably benign	0.00
R3880:Trim30a	UTSW	7	104411189	missense	probably benign
R3911:Trim30a	UTSW	7	104411141	missense	probably damaging	0.98
R3912:Trim30a	UTSW	7	104411141	missense	probably damaging	0.98
R4343:Trim30a	UTSW	7	104435592	missense	probably benign	0.00
R4572:Trim30a	UTSW	7	104411188	nonsense	probably null
R4587:Trim30a	UTSW	7	104435644	nonsense	probably null
R4997:Trim30a	UTSW	7	104411620	missense	probably benign	0.21
R5051:Trim30a	UTSW	7	104411706	intron	probably benign
R5414:Trim30a	UTSW	7	104411141	missense	probably damaging	1.00
R5613:Trim30a	UTSW	7	104430182	missense	probably damaging	1.00
R5930:Trim30a	UTSW	7	104421450	missense	possibly damaging	0.95
R6262:Trim30a	UTSW	7	104411534	missense	probably benign	0.00
R7133:Trim30a	UTSW	7	104429326	missense	possibly damaging	0.93
R7222:Trim30a	UTSW	7	104421432	splice site	probably null
R7739:Trim30a	UTSW	7	104430179	missense	possibly damaging	0.50
R7797:Trim30a	UTSW	7	104411200	missense	possibly damaging	0.86
R7803:Trim30a	UTSW	7	104411397	nonsense	probably null
R7836:Trim30a	UTSW	7	104435595	missense	probably benign	0.06
R7908:Trim30a	UTSW	7	104421449	missense	probably benign	0.01
R7932:Trim30a	UTSW	7	104429338	missense	probably benign	0.00
R7934:Trim30a	UTSW	7	104412241	missense	probably damaging	1.00
R8240:Trim30a	UTSW	7	104421456	missense	probably benign	0.01
R8405:Trim30a	UTSW	7	104411542	nonsense	probably null
X0012:Trim30a	UTSW	7	104430203	nonsense	probably null
Z1088:Trim30a	UTSW	7	104435654	missense	probably damaging	1.00
Z1177:Trim30a	UTSW	7	104411463	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGCATAAGATACACCAGACATGGG -3'
(R):5'- AGCCTAAATGTGGCTACTGGG -3'

Sequencing Primer
(F):5'- CAGACATGGGGGCACTG -3'
(R):5'- GAATCCGTCTGTATACAAGGCCTTTG -3'

Posted On

2015-04-17