Incidental Mutation 'R3910:9030624J02Rik'
ID309342
Institutional Source Beutler Lab
Gene Symbol 9030624J02Rik
Ensembl Gene ENSMUSG00000030982
Gene NameRIKEN cDNA 9030624J02 gene
Synonyms
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118740226-118842966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118746390 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 49 (T49A)
Ref Sequence ENSEMBL: ENSMUSP00000102162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059390] [ENSMUST00000106552] [ENSMUST00000106553] [ENSMUST00000175922]
Predicted Effect probably benign
Transcript: ENSMUST00000059390
AA Change: T73A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051263
Gene: ENSMUSG00000030982
AA Change: T73A

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106552
AA Change: T49A

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102162
Gene: ENSMUSG00000030982
AA Change: T49A

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106553
AA Change: T49A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102163
Gene: ENSMUSG00000030982
AA Change: T49A

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148586
Predicted Effect probably benign
Transcript: ENSMUST00000175922
AA Change: T44A

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134956
Gene: ENSMUSG00000030982
AA Change: T44A

DomainStartEndE-ValueType
low complexity region 42 71 N/A INTRINSIC
Meta Mutation Damage Score 0.0760 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in 9030624J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:9030624J02Rik APN 7 118797047 critical splice donor site probably null
IGL00229:9030624J02Rik APN 7 118804191 splice site probably benign
IGL01066:9030624J02Rik APN 7 118773011 splice site probably null
IGL01433:9030624J02Rik APN 7 118774051 splice site probably null
IGL02381:9030624J02Rik APN 7 118775375 missense probably damaging 1.00
IGL02566:9030624J02Rik APN 7 118752832 missense probably benign 0.04
IGL03199:9030624J02Rik APN 7 118766388 missense probably benign 0.18
IGL03224:9030624J02Rik APN 7 118792553 unclassified probably benign
R0535:9030624J02Rik UTSW 7 118748181 missense possibly damaging 0.95
R1109:9030624J02Rik UTSW 7 118775329 missense probably damaging 0.97
R1378:9030624J02Rik UTSW 7 118794572 nonsense probably null
R1378:9030624J02Rik UTSW 7 118794573 missense probably damaging 1.00
R1412:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R1474:9030624J02Rik UTSW 7 118760213 missense probably damaging 1.00
R1586:9030624J02Rik UTSW 7 118809972 missense probably damaging 1.00
R1785:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1786:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1921:9030624J02Rik UTSW 7 118833748 missense probably damaging 0.98
R1971:9030624J02Rik UTSW 7 118775334 missense probably damaging 1.00
R2038:9030624J02Rik UTSW 7 118811874 missense probably damaging 0.98
R2107:9030624J02Rik UTSW 7 118794539 unclassified probably benign
R2130:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2131:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2132:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2133:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2405:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R2411:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R3911:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3912:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3971:9030624J02Rik UTSW 7 118833799 missense probably damaging 0.98
R4697:9030624J02Rik UTSW 7 118791448 missense probably damaging 1.00
R4964:9030624J02Rik UTSW 7 118780268 missense possibly damaging 0.84
R4980:9030624J02Rik UTSW 7 118807009 missense probably damaging 1.00
R5034:9030624J02Rik UTSW 7 118791388 missense probably damaging 0.99
R5309:9030624J02Rik UTSW 7 118813576 missense probably damaging 1.00
R5312:9030624J02Rik UTSW 7 118813576 missense probably damaging 1.00
R5743:9030624J02Rik UTSW 7 118797011 missense possibly damaging 0.89
R6017:9030624J02Rik UTSW 7 118809921 missense probably damaging 1.00
R6089:9030624J02Rik UTSW 7 118746435 missense possibly damaging 0.76
R6320:9030624J02Rik UTSW 7 118753849 missense probably benign 0.08
R6415:9030624J02Rik UTSW 7 118792646 missense probably damaging 1.00
R6861:9030624J02Rik UTSW 7 118743675 missense probably damaging 1.00
R7034:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7036:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7339:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R7456:9030624J02Rik UTSW 7 118804117 missense probably benign 0.01
R7493:9030624J02Rik UTSW 7 118794577 splice site probably null
R8064:9030624J02Rik UTSW 7 118753924 missense probably damaging 1.00
R8103:9030624J02Rik UTSW 7 118743632 missense probably benign 0.19
R8279:9030624J02Rik UTSW 7 118746499 missense probably benign
R8354:9030624J02Rik UTSW 7 118792572 missense probably benign 0.07
R8454:9030624J02Rik UTSW 7 118792572 missense probably benign 0.07
X0028:9030624J02Rik UTSW 7 118800452 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGAGATACTGGGTCATGCC -3'
(R):5'- GGTGAAACTTCAAACCTCCATC -3'

Sequencing Primer
(F):5'- GGGTCATGCCAGTTTTTCACAGAAC -3'
(R):5'- ACCCACAAGGCCTGCTG -3'
Posted On2015-04-17