Mutagenetix > Incidental Mutations

Incidental Mutation 'R3910:Ints10'

309343

Institutional Source

Beutler Lab

Gene Symbol

Ints10

Ensembl Gene

ENSMUSG00000031864

Gene Name

integrator complex subunit 10

Synonyms

4921521J11Rik

MMRRC Submission

040815-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3910 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68793929-68831667 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68813620 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 478 (S478T)

Ref Sequence

ENSEMBL: ENSMUSP00000105871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034328] [ENSMUST00000070713] [ENSMUST00000110241] [ENSMUST00000110242]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034328
AA Change: S478T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034328
Gene: ENSMUSG00000031864
AA Change: S478T

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000070713
AA Change: S478T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000069908
Gene: ENSMUSG00000031864
AA Change: S478T

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110241
AA Change: S478T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105870
Gene: ENSMUSG00000031864
AA Change: S478T

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110242
AA Change: S478T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105871
Gene: ENSMUSG00000031864
AA Change: S478T

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140309

Meta Mutation Damage Score

0.0596

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	A	T	5: 24,545,442		probably benign	Het
9030624J02Rik	A	G	7: 118,746,390	T49A	possibly damaging	Het
Bod1l	T	C	5: 41,817,098	E2291G	probably damaging	Het
Cchcr1	T	C	17: 35,525,336	V341A	probably damaging	Het
Dsg1c	T	C	18: 20,266,196	V119A	possibly damaging	Het
Fap	A	G	2: 62,556,104	S58P	probably damaging	Het
Flnc	A	T	6: 29,459,427	T2509S	probably damaging	Het
Fnip2	A	T	3: 79,479,505	D971E	possibly damaging	Het
Gab2	A	G	7: 97,299,073	Y290C	probably damaging	Het
Gm7104	C	T	12: 88,284,594		noncoding transcript	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt90	G	A	15: 101,562,783	R15W	probably damaging	Het
Lgr5	A	G	10: 115,587,463	S11P	possibly damaging	Het
Mycn	T	A	12: 12,937,280	N372I	probably damaging	Het
Olfr459	A	G	6: 41,772,149	V50A	probably benign	Het
Olfr700	A	T	7: 106,805,865	V199D	probably damaging	Het
Paxbp1	T	A	16: 91,042,681	E117V	probably damaging	Het
Phc2	T	C	4: 128,743,558		probably null	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Rev3l	A	G	10: 39,820,556	I521M	probably damaging	Het
Robo3	A	T	9: 37,419,295	Y1002N	probably damaging	Het
Svep1	A	T	4: 58,145,156		probably null	Het
Thsd7a	A	G	6: 12,331,549	V1342A	probably damaging	Het
Tmtc3	A	C	10: 100,449,026	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,256,182		probably benign	Het
Trim30a	A	G	7: 104,411,141	V476A	probably damaging	Het
Ugt1a8	A	G	1: 88,088,048	E61G	possibly damaging	Het
Vmn1r75	A	T	7: 11,880,830	N163I	possibly damaging	Het
Zfp119a	G	A	17: 55,866,520	L108F	probably benign	Het

Other mutations in Ints10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Ints10	APN	8	68819333	missense	probably damaging	1.00
IGL00964:Ints10	APN	8	68811986	missense	probably damaging	1.00
IGL02326:Ints10	APN	8	68804833	missense	probably damaging	0.99
R0012:Ints10	UTSW	8	68807475	missense	probably benign	0.01
R0112:Ints10	UTSW	8	68827302	missense	probably damaging	0.99
R1302:Ints10	UTSW	8	68827312	missense	probably damaging	1.00
R1462:Ints10	UTSW	8	68807644	splice site	probably benign
R1540:Ints10	UTSW	8	68796713	splice site	probably benign
R1592:Ints10	UTSW	8	68802903	missense	possibly damaging	0.69
R1845:Ints10	UTSW	8	68794671	missense	probably damaging	1.00
R2144:Ints10	UTSW	8	68796805	missense	probably damaging	1.00
R2323:Ints10	UTSW	8	68819345	missense	probably benign	0.09
R3765:Ints10	UTSW	8	68825119	missense	possibly damaging	0.78
R3912:Ints10	UTSW	8	68813620	missense	probably damaging	0.96
R3913:Ints10	UTSW	8	68813620	missense	probably damaging	0.96
R4050:Ints10	UTSW	8	68827351	missense	probably damaging	1.00
R4151:Ints10	UTSW	8	68794598	splice site	probably null
R4607:Ints10	UTSW	8	68810619	missense	probably damaging	1.00
R4608:Ints10	UTSW	8	68810619	missense	probably damaging	1.00
R4881:Ints10	UTSW	8	68810604	missense	probably benign	0.08
R4911:Ints10	UTSW	8	68827312	missense	probably damaging	0.98
R5255:Ints10	UTSW	8	68793972	start gained	probably benign
R5331:Ints10	UTSW	8	68820820	splice site	probably null
R5461:Ints10	UTSW	8	68794041	missense	possibly damaging	0.59
R5740:Ints10	UTSW	8	68804922	missense	probably damaging	0.96
R5741:Ints10	UTSW	8	68804922	missense	probably damaging	0.96
R6128:Ints10	UTSW	8	68822252	critical splice donor site	probably null
R6465:Ints10	UTSW	8	68807536	missense	probably benign
R6868:Ints10	UTSW	8	68797798	missense	probably damaging	1.00
R6983:Ints10	UTSW	8	68794051	missense	probably damaging	1.00
R7076:Ints10	UTSW	8	68796751	nonsense	probably null
R7216:Ints10	UTSW	8	68822157	missense	probably damaging	0.96
R7652:Ints10	UTSW	8	68825119	missense	possibly damaging	0.78
R8134:Ints10	UTSW	8	68802986	nonsense	probably null
R8176:Ints10	UTSW	8	68802951	missense	probably damaging	1.00
R8185:Ints10	UTSW	8	68796718	missense	possibly damaging	0.51
X0027:Ints10	UTSW	8	68808474	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCCAGAGATGATCATGAAAGTGC -3'
(R):5'- CTGAGTGGTAAAGTCAAACTCAAGG -3'

Sequencing Primer
(F):5'- CAGAGATGATCATGAAAGTGCATTAC -3'
(R):5'- TTGACCTGAAAACCCACTATAGG -3'

Posted On

2015-04-17