Incidental Mutation 'R3910:Ints10'
ID309343
Institutional Source Beutler Lab
Gene Symbol Ints10
Ensembl Gene ENSMUSG00000031864
Gene Nameintegrator complex subunit 10
Synonyms4921521J11Rik
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location68793929-68831667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68813620 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 478 (S478T)
Ref Sequence ENSEMBL: ENSMUSP00000105871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034328] [ENSMUST00000070713] [ENSMUST00000110241] [ENSMUST00000110242]
Predicted Effect probably damaging
Transcript: ENSMUST00000034328
AA Change: S478T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034328
Gene: ENSMUSG00000031864
AA Change: S478T

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070713
AA Change: S478T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069908
Gene: ENSMUSG00000031864
AA Change: S478T

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110241
AA Change: S478T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105870
Gene: ENSMUSG00000031864
AA Change: S478T

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110242
AA Change: S478T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105871
Gene: ENSMUSG00000031864
AA Change: S478T

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140309
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Ints10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Ints10 APN 8 68819333 missense probably damaging 1.00
IGL00964:Ints10 APN 8 68811986 missense probably damaging 1.00
IGL02326:Ints10 APN 8 68804833 missense probably damaging 0.99
R0012:Ints10 UTSW 8 68807475 missense probably benign 0.01
R0112:Ints10 UTSW 8 68827302 missense probably damaging 0.99
R1302:Ints10 UTSW 8 68827312 missense probably damaging 1.00
R1462:Ints10 UTSW 8 68807644 splice site probably benign
R1540:Ints10 UTSW 8 68796713 splice site probably benign
R1592:Ints10 UTSW 8 68802903 missense possibly damaging 0.69
R1845:Ints10 UTSW 8 68794671 missense probably damaging 1.00
R2144:Ints10 UTSW 8 68796805 missense probably damaging 1.00
R2323:Ints10 UTSW 8 68819345 missense probably benign 0.09
R3765:Ints10 UTSW 8 68825119 missense possibly damaging 0.78
R3912:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R3913:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R4050:Ints10 UTSW 8 68827351 missense probably damaging 1.00
R4151:Ints10 UTSW 8 68794598 splice site probably null
R4607:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4608:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4881:Ints10 UTSW 8 68810604 missense probably benign 0.08
R4911:Ints10 UTSW 8 68827312 missense probably damaging 0.98
R5255:Ints10 UTSW 8 68793972 start gained probably benign
R5331:Ints10 UTSW 8 68820820 splice site probably null
R5461:Ints10 UTSW 8 68794041 missense possibly damaging 0.59
R5740:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R5741:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R6128:Ints10 UTSW 8 68822252 critical splice donor site probably null
R6465:Ints10 UTSW 8 68807536 missense probably benign
R6868:Ints10 UTSW 8 68797798 missense probably damaging 1.00
R6983:Ints10 UTSW 8 68794051 missense probably damaging 1.00
R7076:Ints10 UTSW 8 68796751 nonsense probably null
R7216:Ints10 UTSW 8 68822157 missense probably damaging 0.96
R7652:Ints10 UTSW 8 68825119 missense possibly damaging 0.78
R8134:Ints10 UTSW 8 68802986 nonsense probably null
R8176:Ints10 UTSW 8 68802951 missense probably damaging 1.00
R8185:Ints10 UTSW 8 68796718 missense possibly damaging 0.51
X0027:Ints10 UTSW 8 68808474 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCAGAGATGATCATGAAAGTGC -3'
(R):5'- CTGAGTGGTAAAGTCAAACTCAAGG -3'

Sequencing Primer
(F):5'- CAGAGATGATCATGAAAGTGCATTAC -3'
(R):5'- TTGACCTGAAAACCCACTATAGG -3'
Posted On2015-04-17