Incidental Mutation 'R3910:Robo3'
ID309344
Institutional Source Beutler Lab
Gene Symbol Robo3
Ensembl Gene ENSMUSG00000032128
Gene Nameroundabout guidance receptor 3
SynonymsRig1, Rig-1, Robo3b, Robo3a, Rbig1
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37415669-37433246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37419295 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1002 (Y1002N)
Ref Sequence ENSEMBL: ENSMUSP00000110690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000115038] [ENSMUST00000170512] [ENSMUST00000214185]
Predicted Effect probably damaging
Transcript: ENSMUST00000034643
AA Change: Y980N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128
AA Change: Y980N

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115038
AA Change: Y1002N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128
AA Change: Y1002N

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167216
Predicted Effect probably benign
Transcript: ENSMUST00000170512
AA Change: Y980N

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171467
Predicted Effect probably benign
Transcript: ENSMUST00000214185
Meta Mutation Damage Score 0.1347 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal commissural axon growth, and fragile floor plates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Robo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Robo3 APN 9 37427754 critical splice donor site probably null
IGL01023:Robo3 APN 9 37429551 missense probably damaging 1.00
IGL01431:Robo3 APN 9 37419111 unclassified probably benign
IGL01993:Robo3 APN 9 37424653 missense probably damaging 1.00
IGL02256:Robo3 APN 9 37425353 missense probably damaging 1.00
IGL02323:Robo3 APN 9 37422201 missense probably benign 0.05
IGL02561:Robo3 APN 9 37427091 missense possibly damaging 0.84
IGL02866:Robo3 APN 9 37422306 missense possibly damaging 0.89
IGL02897:Robo3 APN 9 37427502 nonsense probably null
IGL03003:Robo3 APN 9 37419291 missense probably damaging 1.00
IGL03307:Robo3 APN 9 37422564 missense probably damaging 0.96
IGL03097:Robo3 UTSW 9 37422528 critical splice donor site probably null
R0137:Robo3 UTSW 9 37425344 missense probably benign 0.00
R0266:Robo3 UTSW 9 37422640 missense probably damaging 0.96
R0390:Robo3 UTSW 9 37422177 missense probably benign 0.00
R0505:Robo3 UTSW 9 37416759 unclassified probably benign
R0815:Robo3 UTSW 9 37422183 missense probably damaging 1.00
R0924:Robo3 UTSW 9 37429482 splice site probably benign
R1167:Robo3 UTSW 9 37423907 nonsense probably null
R1203:Robo3 UTSW 9 37418682 missense probably damaging 1.00
R1451:Robo3 UTSW 9 37417711 missense probably benign 0.01
R1575:Robo3 UTSW 9 37429661 missense probably damaging 1.00
R1596:Robo3 UTSW 9 37424632 critical splice donor site probably null
R1660:Robo3 UTSW 9 37429144 missense probably damaging 1.00
R1677:Robo3 UTSW 9 37417709 missense possibly damaging 0.75
R1839:Robo3 UTSW 9 37422327 missense probably benign 0.00
R1878:Robo3 UTSW 9 37422165 missense probably damaging 1.00
R1891:Robo3 UTSW 9 37428055 missense probably damaging 1.00
R2040:Robo3 UTSW 9 37427464 missense probably damaging 1.00
R2859:Robo3 UTSW 9 37428104 nonsense probably null
R3786:Robo3 UTSW 9 37422225 missense probably damaging 1.00
R3886:Robo3 UTSW 9 37422181 nonsense probably null
R3888:Robo3 UTSW 9 37422181 nonsense probably null
R4212:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4213:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4691:Robo3 UTSW 9 37425218 missense probably damaging 0.99
R4979:Robo3 UTSW 9 37423344 missense probably damaging 1.00
R5238:Robo3 UTSW 9 37416879 missense probably damaging 0.99
R5570:Robo3 UTSW 9 37425275 missense possibly damaging 0.81
R5629:Robo3 UTSW 9 37419211 nonsense probably null
R5770:Robo3 UTSW 9 37419201 missense possibly damaging 0.87
R5837:Robo3 UTSW 9 37429816 critical splice acceptor site probably null
R6021:Robo3 UTSW 9 37422533 nonsense probably null
R6129:Robo3 UTSW 9 37423293 missense probably benign
R6232:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6233:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6235:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6326:Robo3 UTSW 9 37427027 missense probably damaging 1.00
R6354:Robo3 UTSW 9 37417217 unclassified probably benign
R6355:Robo3 UTSW 9 37418939 missense possibly damaging 0.71
R6475:Robo3 UTSW 9 37423290 missense probably damaging 0.99
R6937:Robo3 UTSW 9 37429880 missense probably benign 0.16
R7201:Robo3 UTSW 9 37424330 nonsense probably null
R7208:Robo3 UTSW 9 37424724 missense probably damaging 0.99
R7249:Robo3 UTSW 9 37424833 missense probably benign
R7376:Robo3 UTSW 9 37432916 missense probably damaging 1.00
R7380:Robo3 UTSW 9 37418556 missense probably damaging 1.00
R7448:Robo3 UTSW 9 37424815 missense possibly damaging 0.89
R7475:Robo3 UTSW 9 37425378 missense probably benign 0.01
R7496:Robo3 UTSW 9 37427825 missense probably damaging 1.00
R7587:Robo3 UTSW 9 37429646 missense probably damaging 1.00
R7694:Robo3 UTSW 9 37418520 missense probably benign 0.14
R8381:Robo3 UTSW 9 37429760 missense probably damaging 1.00
R8464:Robo3 UTSW 9 37421430 missense probably damaging 1.00
R8495:Robo3 UTSW 9 37425368 missense probably damaging 1.00
X0024:Robo3 UTSW 9 37427855 missense probably damaging 1.00
X0027:Robo3 UTSW 9 37427825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGAGGGTCATACCACTG -3'
(R):5'- GACCTTGGGCTTGAGCTATATAG -3'

Sequencing Primer
(F):5'- AGGGTCATACCACTGTCCCC -3'
(R):5'- AGCAATCAGTCCTTAACCTTGG -3'
Posted On2015-04-17