Mutagenetix > Incidental Mutations

Incidental Mutation 'R3910:Rev3l'

309345

Institutional Source

Beutler Lab

Gene Symbol

Rev3l

Ensembl Gene

ENSMUSG00000019841

Gene Name

REV3 like, DNA directed polymerase zeta catalytic subunit

Synonyms

Sez4, Rev

MMRRC Submission

040815-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3910 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39732118-39875211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 39820556 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 521 (I521M)

Ref Sequence

ENSEMBL: ENSMUSP00000131519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]

Predicted Effect

probably damaging
Transcript: ENSMUST00000019986
AA Change: I521M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: I521M

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	201	1.6e-10	PFAM
low complexity region	494	506	N/A	INTRINSIC
low complexity region	959	969	N/A	INTRINSIC
low complexity region	1042	1057	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3103	8.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131186

Predicted Effect

probably benign
Transcript: ENSMUST00000139803

SMART Domains

Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

Domain	Start	End	E-Value	Type
Blast:POLBc	1	369	1e-155	BLAST
POLBc	434	805	4.77e-34	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000164763
AA Change: I521M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: I521M

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	200	1.3e-11	PFAM
low complexity region	494	506	N/A	INTRINSIC
Pfam:DUF4683	745	1132	1.7e-162	PFAM
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3102	6.1e-15	PFAM

Meta Mutation Damage Score

0.1114

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	A	T	5: 24,545,442		probably benign	Het
9030624J02Rik	A	G	7: 118,746,390	T49A	possibly damaging	Het
Bod1l	T	C	5: 41,817,098	E2291G	probably damaging	Het
Cchcr1	T	C	17: 35,525,336	V341A	probably damaging	Het
Dsg1c	T	C	18: 20,266,196	V119A	possibly damaging	Het
Fap	A	G	2: 62,556,104	S58P	probably damaging	Het
Flnc	A	T	6: 29,459,427	T2509S	probably damaging	Het
Fnip2	A	T	3: 79,479,505	D971E	possibly damaging	Het
Gab2	A	G	7: 97,299,073	Y290C	probably damaging	Het
Gm7104	C	T	12: 88,284,594		noncoding transcript	Het
Ints10	T	A	8: 68,813,620	S478T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt90	G	A	15: 101,562,783	R15W	probably damaging	Het
Lgr5	A	G	10: 115,587,463	S11P	possibly damaging	Het
Mycn	T	A	12: 12,937,280	N372I	probably damaging	Het
Olfr459	A	G	6: 41,772,149	V50A	probably benign	Het
Olfr700	A	T	7: 106,805,865	V199D	probably damaging	Het
Paxbp1	T	A	16: 91,042,681	E117V	probably damaging	Het
Phc2	T	C	4: 128,743,558		probably null	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Robo3	A	T	9: 37,419,295	Y1002N	probably damaging	Het
Svep1	A	T	4: 58,145,156		probably null	Het
Thsd7a	A	G	6: 12,331,549	V1342A	probably damaging	Het
Tmtc3	A	C	10: 100,449,026	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,256,182		probably benign	Het
Trim30a	A	G	7: 104,411,141	V476A	probably damaging	Het
Ugt1a8	A	G	1: 88,088,048	E61G	possibly damaging	Het
Vmn1r75	A	T	7: 11,880,830	N163I	possibly damaging	Het
Zfp119a	G	A	17: 55,866,520	L108F	probably benign	Het

Other mutations in Rev3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Rev3l	APN	10	39806969	missense	probably benign
IGL00815:Rev3l	APN	10	39859153	missense	possibly damaging	0.79
IGL00964:Rev3l	APN	10	39864806	missense	probably benign	0.39
IGL01765:Rev3l	APN	10	39828265	missense	probably benign	0.00
IGL01792:Rev3l	APN	10	39823340	missense	probably benign
IGL01950:Rev3l	APN	10	39821157	missense	probably damaging	1.00
IGL01963:Rev3l	APN	10	39822737	missense	possibly damaging	0.90
IGL02089:Rev3l	APN	10	39825099	missense	probably damaging	1.00
IGL02288:Rev3l	APN	10	39828216	missense	probably benign
IGL02381:Rev3l	APN	10	39821346	missense	possibly damaging	0.83
IGL02409:Rev3l	APN	10	39821148	missense	possibly damaging	0.75
IGL02434:Rev3l	APN	10	39822591	missense	probably damaging	1.00
IGL02570:Rev3l	APN	10	39848013	missense	possibly damaging	0.68
IGL02581:Rev3l	APN	10	39821281	missense	probably benign	0.10
IGL02654:Rev3l	APN	10	39862734	missense	probably damaging	1.00
IGL02720:Rev3l	APN	10	39822395	nonsense	probably null
IGL02746:Rev3l	APN	10	39824589	missense	probably damaging	0.99
IGL02829:Rev3l	APN	10	39825240	missense	probably damaging	1.00
IGL02961:Rev3l	APN	10	39827945	missense	possibly damaging	0.65
IGL02974:Rev3l	APN	10	39862747	nonsense	probably null
IGL03029:Rev3l	APN	10	39828486	missense	probably benign	0.34
IGL03153:Rev3l	APN	10	39806878	missense	probably damaging	1.00
IGL03172:Rev3l	APN	10	39824790	missense	probably benign	0.10
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0153:Rev3l	UTSW	10	39874128	nonsense	probably null
R0308:Rev3l	UTSW	10	39824894	missense	probably benign	0.09
R0355:Rev3l	UTSW	10	39817286	missense	probably damaging	1.00
R0513:Rev3l	UTSW	10	39828143	missense	probably benign	0.00
R0523:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R0559:Rev3l	UTSW	10	39824487	missense	probably damaging	1.00
R0761:Rev3l	UTSW	10	39874195	missense	probably benign	0.32
R1023:Rev3l	UTSW	10	39832639	missense	probably damaging	1.00
R1159:Rev3l	UTSW	10	39851925	nonsense	probably null
R1398:Rev3l	UTSW	10	39821583	missense	probably benign	0.05
R1478:Rev3l	UTSW	10	39783333	critical splice donor site	probably null
R1517:Rev3l	UTSW	10	39838443	missense	probably benign	0.34
R1527:Rev3l	UTSW	10	39822822	missense	probably damaging	1.00
R1635:Rev3l	UTSW	10	39806662	missense	probably damaging	0.98
R1695:Rev3l	UTSW	10	39824615	nonsense	probably null
R1695:Rev3l	UTSW	10	39824616	missense	probably damaging	0.97
R1782:Rev3l	UTSW	10	39799885	missense	probably benign
R1815:Rev3l	UTSW	10	39822871	missense	probably benign	0.41
R1818:Rev3l	UTSW	10	39828424	missense	probably benign	0.05
R2039:Rev3l	UTSW	10	39824444	missense	probably damaging	1.00
R2071:Rev3l	UTSW	10	39824353	missense	probably benign	0.17
R2101:Rev3l	UTSW	10	39828096	missense	probably benign	0.00
R2141:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R2883:Rev3l	UTSW	10	39825156	missense	probably damaging	1.00
R3787:Rev3l	UTSW	10	39846210	missense	probably damaging	0.97
R3912:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3913:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R4590:Rev3l	UTSW	10	39806933	missense	probably damaging	1.00
R4631:Rev3l	UTSW	10	39828416	missense	probably benign	0.44
R4633:Rev3l	UTSW	10	39846186	missense	probably damaging	1.00
R4707:Rev3l	UTSW	10	39823397	missense	probably damaging	0.99
R4724:Rev3l	UTSW	10	39846806	nonsense	probably null
R4810:Rev3l	UTSW	10	39823725	missense	probably benign	0.01
R4857:Rev3l	UTSW	10	39838459	missense	probably damaging	1.00
R4882:Rev3l	UTSW	10	39821460	missense	possibly damaging	0.89
R4928:Rev3l	UTSW	10	39823985	missense	probably benign	0.30
R4970:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R4977:Rev3l	UTSW	10	39823578	missense	possibly damaging	0.80
R5112:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R5261:Rev3l	UTSW	10	39846729	missense	probably damaging	1.00
R5419:Rev3l	UTSW	10	39824931	missense	possibly damaging	0.95
R5570:Rev3l	UTSW	10	39852075	critical splice donor site	probably null
R5628:Rev3l	UTSW	10	39822967	missense	probably damaging	0.98
R5689:Rev3l	UTSW	10	39794958	missense	probably damaging	1.00
R5781:Rev3l	UTSW	10	39823093	missense	probably benign	0.00
R5829:Rev3l	UTSW	10	39806906	missense	probably damaging	0.97
R5984:Rev3l	UTSW	10	39742689	intron	probably benign
R5990:Rev3l	UTSW	10	39823811	missense	probably benign	0.17
R6054:Rev3l	UTSW	10	39824150	missense	probably benign	0.01
R6171:Rev3l	UTSW	10	39862713	nonsense	probably null
R6220:Rev3l	UTSW	10	39822779	missense	probably damaging	1.00
R6520:Rev3l	UTSW	10	39822702	missense	probably benign	0.06
R6798:Rev3l	UTSW	10	39854763	missense	probably damaging	1.00
R6811:Rev3l	UTSW	10	39830921	nonsense	probably null
R6812:Rev3l	UTSW	10	39823548	missense	probably benign
R6904:Rev3l	UTSW	10	39821481	missense	probably benign
R6905:Rev3l	UTSW	10	39817327	missense	probably benign	0.18
R6938:Rev3l	UTSW	10	39862710	missense	probably damaging	1.00
R7037:Rev3l	UTSW	10	39851975	missense	probably damaging	1.00
R7124:Rev3l	UTSW	10	39822167	nonsense	probably null
R7286:Rev3l	UTSW	10	39823605	missense	probably damaging	0.99
R7385:Rev3l	UTSW	10	39823682	missense	probably benign	0.01
R7575:Rev3l	UTSW	10	39821445	missense	possibly damaging	0.56
R7596:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R7597:Rev3l	UTSW	10	39822884	missense	probably damaging	1.00
R7670:Rev3l	UTSW	10	39836722	missense	probably benign	0.01
R7804:Rev3l	UTSW	10	39823485	missense	probably benign	0.34
R7818:Rev3l	UTSW	10	39823902	missense	possibly damaging	0.54
R7874:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R7991:Rev3l	UTSW	10	39863738	missense	possibly damaging	0.52
R8059:Rev3l	UTSW	10	39843495	missense	probably damaging	1.00
R8174:Rev3l	UTSW	10	39859115	missense	probably damaging	1.00
R8187:Rev3l	UTSW	10	39806697	missense	probably benign
R8299:Rev3l	UTSW	10	39821541	missense	probably benign	0.01
R8352:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8452:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8468:Rev3l	UTSW	10	39827991	missense	probably damaging	0.99
R8487:Rev3l	UTSW	10	39806848	missense	probably damaging	1.00
R8512:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R8554:Rev3l	UTSW	10	39806842	missense	probably benign	0.12
X0022:Rev3l	UTSW	10	39828607	critical splice donor site	probably null
Z1088:Rev3l	UTSW	10	39824318	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- TTTTGCCGGTCCTGTAGCAG -3'
(R):5'- CCTACCCTCTTTAGAATAAGCAATC -3'

Sequencing Primer
(F):5'- TCCAGACAGTTGTGAGCCATCATG -3'
(R):5'- TCTTTAGAATAAGCAATCACACAGC -3'

Posted On

2015-04-17