Incidental Mutation 'R3910:Lgr5'
ID309347
Institutional Source Beutler Lab
Gene Symbol Lgr5
Ensembl Gene ENSMUSG00000020140
Gene Nameleucine rich repeat containing G protein coupled receptor 5
SynonymsGpr49
MMRRC Submission 040815-MU
Accession Numbers

Ncbi RefSeq: NM_010195.2; MGI: 1341817

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3910 (G1)
Quality Score163
Status Validated
Chromosome10
Chromosomal Location115450311-115587780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115587463 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 11 (S11P)
Ref Sequence ENSEMBL: ENSMUSP00000133707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020350] [ENSMUST00000172806] [ENSMUST00000173740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020350
AA Change: S11P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020350
Gene: ENSMUSG00000020140
AA Change: S11P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR_TYP 256 279 1.38e-3 SMART
Blast:LRR 281 303 2e-6 BLAST
Blast:LRR 304 328 1e-5 BLAST
LRR_TYP 351 374 1.56e-2 SMART
LRR 375 396 1.09e2 SMART
LRR_TYP 397 420 7.26e-3 SMART
LRR 421 444 2.86e-1 SMART
low complexity region 518 533 N/A INTRINSIC
Pfam:7tm_1 574 820 9.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149008
Predicted Effect possibly damaging
Transcript: ENSMUST00000172806
AA Change: S11P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133860
Gene: ENSMUSG00000020140
AA Change: S11P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR 256 279 6.57e-1 SMART
Blast:LRR 280 304 1e-5 BLAST
LRR_TYP 327 350 1.56e-2 SMART
LRR 351 372 1.09e2 SMART
LRR_TYP 373 396 7.26e-3 SMART
LRR 397 420 2.86e-1 SMART
low complexity region 494 509 N/A INTRINSIC
Pfam:7tm_1 550 796 8.2e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173740
AA Change: S11P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133707
Gene: ENSMUSG00000020140
AA Change: S11P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.08e-4 SMART
LRR 161 183 9.75e0 SMART
LRR_TYP 184 207 1.38e-3 SMART
Blast:LRR 209 231 1e-6 BLAST
Blast:LRR 232 256 1e-5 BLAST
LRR_TYP 279 302 1.56e-2 SMART
LRR 303 324 1.09e2 SMART
LRR_TYP 325 348 7.26e-3 SMART
LRR 349 372 2.86e-1 SMART
low complexity region 446 461 N/A INTRINSIC
Pfam:7tm_1 502 748 7.4e-16 PFAM
Meta Mutation Damage Score 0.0991 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype Strain: 3512420
Lethality: D1-D2
FUNCTION: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display 100% neonatal lethality associated with ankyloglossia, gastrointestinal distension, cyanosis and respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Lgr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lgr5 APN 10 115454464 missense possibly damaging 0.69
IGL01291:Lgr5 APN 10 115478534 missense probably damaging 1.00
IGL01432:Lgr5 APN 10 115453092 missense probably damaging 1.00
IGL01778:Lgr5 APN 10 115462702 missense probably damaging 0.97
IGL01936:Lgr5 APN 10 115452414 missense probably damaging 1.00
IGL02079:Lgr5 APN 10 115452194 missense probably damaging 1.00
IGL02134:Lgr5 APN 10 115452858 missense possibly damaging 0.89
IGL03083:Lgr5 APN 10 115453032 missense probably benign 0.26
IGL03350:Lgr5 APN 10 115471988 missense probably damaging 0.99
anger UTSW 10 115466346 missense probably benign 0.03
ANU05:Lgr5 UTSW 10 115478534 missense probably damaging 1.00
R0378:Lgr5 UTSW 10 115454499 missense probably damaging 1.00
R0788:Lgr5 UTSW 10 115452997 missense probably damaging 0.99
R1119:Lgr5 UTSW 10 115460811 critical splice donor site probably null
R1321:Lgr5 UTSW 10 115478457 missense probably damaging 1.00
R1880:Lgr5 UTSW 10 115452279 missense probably damaging 1.00
R1985:Lgr5 UTSW 10 115495245 splice site probably benign
R2434:Lgr5 UTSW 10 115587406 missense probably benign
R3055:Lgr5 UTSW 10 115466123 splice site probably benign
R4686:Lgr5 UTSW 10 115458743 intron probably benign
R4862:Lgr5 UTSW 10 115462764 missense probably damaging 1.00
R4866:Lgr5 UTSW 10 115452685 missense probably benign 0.00
R5089:Lgr5 UTSW 10 115478423 missense probably damaging 1.00
R5118:Lgr5 UTSW 10 115452339 missense possibly damaging 0.88
R5375:Lgr5 UTSW 10 115478564 missense probably benign 0.00
R5537:Lgr5 UTSW 10 115456689 missense probably benign 0.00
R5583:Lgr5 UTSW 10 115478504 missense probably benign 0.32
R6312:Lgr5 UTSW 10 115452924 missense probably damaging 1.00
R6362:Lgr5 UTSW 10 115478525 missense probably damaging 1.00
R6605:Lgr5 UTSW 10 115457867 missense possibly damaging 0.69
R6689:Lgr5 UTSW 10 115466608 missense probably damaging 0.99
R6705:Lgr5 UTSW 10 115587288 missense probably damaging 0.96
R6925:Lgr5 UTSW 10 115466346 missense probably benign 0.03
R7063:Lgr5 UTSW 10 115456734 missense probably damaging 1.00
R7261:Lgr5 UTSW 10 115587465 missense possibly damaging 0.96
R7274:Lgr5 UTSW 10 115452505 missense probably damaging 0.99
R7458:Lgr5 UTSW 10 115457755 critical splice donor site probably null
R7569:Lgr5 UTSW 10 115462756 missense probably damaging 1.00
R7770:Lgr5 UTSW 10 115471994 missense probably damaging 0.98
R7936:Lgr5 UTSW 10 115453047 missense probably damaging 0.99
R7964:Lgr5 UTSW 10 115452174 missense probably benign 0.00
R8085:Lgr5 UTSW 10 115475197 missense probably benign
R8537:Lgr5 UTSW 10 115452402 missense probably damaging 1.00
Z1176:Lgr5 UTSW 10 115460876 missense probably damaging 0.98
Z1177:Lgr5 UTSW 10 115456669 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCACTTACAGGTAGGAGGTG -3'
(R):5'- TTTCACATCTCAGTCGCGGG -3'

Sequencing Primer
(F):5'- TCACTTACAGGTAGGAGGTGAAGAC -3'
(R):5'- TGGGACCACGATTCTCTGC -3'
Posted On2015-04-17