Incidental Mutation 'R3910:Mycn'
ID309348
Institutional Source Beutler Lab
Gene Symbol Mycn
Ensembl Gene ENSMUSG00000037169
Gene Namev-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived
SynonymsbHLHe37, Nmyc, Nmyc-1, N-myc, Nmyc1
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location12936093-12941914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12937280 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 372 (N372I)
Ref Sequence ENSEMBL: ENSMUSP00000114225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043396] [ENSMUST00000130990]
Predicted Effect probably damaging
Transcript: ENSMUST00000043396
AA Change: N372I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045993
Gene: ENSMUSG00000037169
AA Change: N372I

DomainStartEndE-ValueType
Pfam:Myc_N 8 370 1.4e-120 PFAM
HLH 385 437 1.09e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130990
AA Change: N372I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114225
Gene: ENSMUSG00000037169
AA Change: N372I

DomainStartEndE-ValueType
Pfam:Myc_N 9 370 1.1e-148 PFAM
HLH 385 437 1.09e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151534
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MYC family and encodes a protein with a basic helix-loop-helix (bHLH) domain. This protein is located in the nucleus and must dimerize with another bHLH protein in order to bind DNA. Amplification of this gene is associated with a variety of tumors, most notably neuroblastomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired development of the mesonephric tubules, neuroepithelium, sensory ganglia, heart, lung, stomach, and liver. Mutants die around embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Mycn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Mycn APN 12 12937586 missense possibly damaging 0.91
IGL02012:Mycn APN 12 12937103 missense probably damaging 1.00
IGL02808:Mycn APN 12 12939892 missense probably benign
PIT4581001:Mycn UTSW 12 12940243 missense possibly damaging 0.82
R0282:Mycn UTSW 12 12937313 missense probably benign 0.02
R4943:Mycn UTSW 12 12937079 missense probably damaging 1.00
R5667:Mycn UTSW 12 12940044 missense possibly damaging 0.73
R5827:Mycn UTSW 12 12939793 nonsense probably null
R6594:Mycn UTSW 12 12940050 missense probably damaging 0.96
R7513:Mycn UTSW 12 12939742 missense probably benign 0.00
R7560:Mycn UTSW 12 12940291 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGCGTGTTCGATCTTCTTTAGC -3'
(R):5'- GATCCTCAAGCGCTGTGTTC -3'

Sequencing Primer
(F):5'- GTGTTCGATCTTCTTTAGCAACTG -3'
(R):5'- GTGTTCCCATCCATCAGCAG -3'
Posted On2015-04-17