Incidental Mutation 'R3910:Gm7104'
ID309349
Institutional Source Beutler Lab
Gene Symbol Gm7104
Ensembl Gene ENSMUSG00000094635
Gene Namepredicted gene 7104
Synonyms
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R3910 (G1)
Quality Score172
Status Validated
Chromosome12
Chromosomal Location88284535-88286055 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 88284594 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179741
SMART Domains Protein: ENSMUSP00000136935
Gene: ENSMUSG00000094635

DomainStartEndE-ValueType
Pfam:EloA-BP1 80 248 1.6e-64 PFAM
EXOIII 345 504 5.07e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223359
Meta Mutation Damage Score 0.4666 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Gm7104
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0630:Gm7104 UTSW 12 88285709 unclassified noncoding transcript
R1485:Gm7104 UTSW 12 88285563 unclassified noncoding transcript
R2044:Gm7104 UTSW 12 88285781 unclassified noncoding transcript
R2567:Gm7104 UTSW 12 88285472 unclassified noncoding transcript
R3177:Gm7104 UTSW 12 88285728 unclassified noncoding transcript
R3277:Gm7104 UTSW 12 88285728 unclassified noncoding transcript
R3778:Gm7104 UTSW 12 88285671 unclassified noncoding transcript
R3946:Gm7104 UTSW 12 88286042 unclassified noncoding transcript
R4754:Gm7104 UTSW 12 88285995 unclassified noncoding transcript
R5022:Gm7104 UTSW 12 88285759 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACCTGAAGCAAAAGCTCTGG -3'
(R):5'- TCATTGGACACAGCCTGGAG -3'

Sequencing Primer
(F):5'- AGGCATGTGGTCAGCTATCAC -3'
(R):5'- GAGCGACCTACTGGCTCTCAAAG -3'
Posted On2015-04-17