Incidental Mutation 'R3910:Tnfrsf11b'
ID 309350
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11b
Ensembl Gene ENSMUSG00000063727
Gene Name tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
Synonyms OPG, OCIF, TR1, osteoclastogenesis inhibitory factor, Opg
MMRRC Submission 040815-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R3910 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 54114014-54141700 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 54119578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079772]
AlphaFold O08712
PDB Structure Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000079772
SMART Domains Protein: ENSMUSP00000078705
Gene: ENSMUSG00000063727

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 24 62 1.04e-2 SMART
TNFR 65 105 1.5e-8 SMART
TNFR 107 142 2.19e-10 SMART
TNFR 145 185 7.63e-1 SMART
DEATH 270 365 1.01e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have abnormal bone remodeling that results in severe osteoperosis with increased risk of fractures and growth retardation. Progressive hearing loss also results due to abnormal remodeling of the otic capsule. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bod1l T C 5: 41,974,441 (GRCm39) E2291G probably damaging Het
Cchcr1 T C 17: 35,836,233 (GRCm39) V341A probably damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Dsg1c T C 18: 20,399,253 (GRCm39) V119A possibly damaging Het
Fap A G 2: 62,386,448 (GRCm39) S58P probably damaging Het
Flnc A T 6: 29,459,426 (GRCm39) T2509S probably damaging Het
Fnip2 A T 3: 79,386,812 (GRCm39) D971E possibly damaging Het
Gab2 A G 7: 96,948,280 (GRCm39) Y290C probably damaging Het
Gm7104 C T 12: 88,251,364 (GRCm39) noncoding transcript Het
Ints10 T A 8: 69,266,272 (GRCm39) S478T probably damaging Het
Iqca1l A T 5: 24,750,440 (GRCm39) probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt90 G A 15: 101,471,218 (GRCm39) R15W probably damaging Het
Lgr5 A G 10: 115,423,368 (GRCm39) S11P possibly damaging Het
Mycn T A 12: 12,987,281 (GRCm39) N372I probably damaging Het
Or2ag18 A T 7: 106,405,072 (GRCm39) V199D probably damaging Het
Or9a2 A G 6: 41,749,083 (GRCm39) V50A probably benign Het
Paxbp1 T A 16: 90,839,569 (GRCm39) E117V probably damaging Het
Phc2 T C 4: 128,637,351 (GRCm39) probably null Het
Prr5 T A 15: 84,587,345 (GRCm39) V365E probably benign Het
Rev3l A G 10: 39,696,552 (GRCm39) I521M probably damaging Het
Robo3 A T 9: 37,330,591 (GRCm39) Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 (GRCm39) probably null Het
Thsd7a A G 6: 12,331,548 (GRCm39) V1342A probably damaging Het
Tmtc3 A C 10: 100,284,888 (GRCm39) N582K probably damaging Het
Trim30a A G 7: 104,060,348 (GRCm39) V476A probably damaging Het
Ugt1a8 A G 1: 88,015,770 (GRCm39) E61G possibly damaging Het
Vmn1r75 A T 7: 11,614,757 (GRCm39) N163I possibly damaging Het
Vps35l A G 7: 118,345,613 (GRCm39) T49A possibly damaging Het
Zfp119a G A 17: 56,173,520 (GRCm39) L108F probably benign Het
Other mutations in Tnfrsf11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnfrsf11b APN 15 54,123,238 (GRCm39) missense probably damaging 1.00
IGL00770:Tnfrsf11b APN 15 54,117,468 (GRCm39) missense probably benign 0.16
IGL00774:Tnfrsf11b APN 15 54,117,468 (GRCm39) missense probably benign 0.16
IGL02355:Tnfrsf11b APN 15 54,115,778 (GRCm39) missense probably damaging 0.96
IGL02362:Tnfrsf11b APN 15 54,115,778 (GRCm39) missense probably damaging 0.96
IGL02711:Tnfrsf11b APN 15 54,119,532 (GRCm39) missense probably benign 0.01
IGL02870:Tnfrsf11b APN 15 54,119,423 (GRCm39) missense probably benign 0.05
IGL03219:Tnfrsf11b APN 15 54,117,574 (GRCm39) nonsense probably null
P0012:Tnfrsf11b UTSW 15 54,123,194 (GRCm39) splice site probably benign
R1550:Tnfrsf11b UTSW 15 54,117,454 (GRCm39) missense possibly damaging 0.94
R1813:Tnfrsf11b UTSW 15 54,119,493 (GRCm39) nonsense probably null
R3840:Tnfrsf11b UTSW 15 54,115,478 (GRCm39) missense probably damaging 0.99
R3911:Tnfrsf11b UTSW 15 54,119,578 (GRCm39) splice site probably benign
R3912:Tnfrsf11b UTSW 15 54,119,578 (GRCm39) splice site probably benign
R4299:Tnfrsf11b UTSW 15 54,115,491 (GRCm39) missense probably benign
R4362:Tnfrsf11b UTSW 15 54,119,555 (GRCm39) missense possibly damaging 0.94
R4363:Tnfrsf11b UTSW 15 54,119,555 (GRCm39) missense possibly damaging 0.94
R5288:Tnfrsf11b UTSW 15 54,141,622 (GRCm39) missense probably benign 0.00
R5653:Tnfrsf11b UTSW 15 54,123,262 (GRCm39) missense probably damaging 1.00
R5753:Tnfrsf11b UTSW 15 54,117,455 (GRCm39) missense possibly damaging 0.90
R6881:Tnfrsf11b UTSW 15 54,117,539 (GRCm39) missense probably benign 0.00
R6997:Tnfrsf11b UTSW 15 54,115,770 (GRCm39) missense probably damaging 0.99
R7704:Tnfrsf11b UTSW 15 54,123,497 (GRCm39) missense probably benign 0.30
R7730:Tnfrsf11b UTSW 15 54,117,470 (GRCm39) nonsense probably null
R8017:Tnfrsf11b UTSW 15 54,117,598 (GRCm39) nonsense probably null
R8052:Tnfrsf11b UTSW 15 54,115,502 (GRCm39) missense probably damaging 1.00
R8060:Tnfrsf11b UTSW 15 54,117,505 (GRCm39) missense probably benign 0.38
R8711:Tnfrsf11b UTSW 15 54,123,508 (GRCm39) missense possibly damaging 0.81
R9224:Tnfrsf11b UTSW 15 54,115,556 (GRCm39) missense possibly damaging 0.67
X0025:Tnfrsf11b UTSW 15 54,141,631 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTCTGTTTCCGGAACACACG -3'
(R):5'- AGCGCAACAAACTTGTGTGG -3'

Sequencing Primer
(F):5'- TCCGGAACACACGTTGTCATG -3'
(R):5'- CGCAACAAACTTGTGTGGGTATTAC -3'
Posted On 2015-04-17