Mutagenetix > Incidental Mutations

Incidental Mutation 'R3911:Fasl'

309360

Institutional Source

Beutler Lab

Gene Symbol

Fasl

Ensembl Gene

ENSMUSG00000000817

Gene Name

Fas ligand (TNF superfamily, member 6)

Synonyms

APT1LG1, CD178, CD95L, Fas-L, Tnfsf6

MMRRC Submission

040909-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R3911 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

161780689-161788495 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 161788191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 32 (C32F)

Ref Sequence

ENSEMBL: ENSMUSP00000000834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000834] [ENSMUST00000193648]

AlphaFold

P41047

Predicted Effect

probably benign
Transcript: ENSMUST00000000834
AA Change: C32F

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000000834
Gene: ENSMUSG00000000817
AA Change: C32F

Domain	Start	End	E-Value	Type
low complexity region	45	70	N/A	INTRINSIC
transmembrane domain	78	100	N/A	INTRINSIC
TNF	143	279	2.29e-54	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193648

SMART Domains

Protein: ENSMUSP00000141422
Gene: ENSMUSG00000000817

Domain	Start	End	E-Value	Type
Pfam:TNF	1	69	2.3e-15	PFAM

Meta Mutation Damage Score

0.1383

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a spontaneous allele, knock-out allele, or allele producting only the soluble isoform exhibit premature death due to the development of systemic lupus erythematosus, autoimmune glomerulonephritis, hepatomegaly, lymphadenopathy, and hypergammaglobulinaemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	A	T	5: 24,545,442		probably benign	Het
9030624J02Rik	A	G	7: 118,746,390	T49A	possibly damaging	Het
Abcb9	T	A	5: 124,089,846	I111F	probably benign	Het
Abcc12	A	C	8: 86,528,419		probably benign	Het
Adgre1	G	T	17: 57,447,860	V653L	probably damaging	Het
Aebp2	T	A	6: 140,647,981	D230E	probably damaging	Het
Asap3	A	G	4: 136,229,457		probably benign	Het
Bod1l	T	C	5: 41,817,098	E2291G	probably damaging	Het
Casp8	A	T	1: 58,833,705	S267C	probably damaging	Het
Cchcr1	T	C	17: 35,525,336	V341A	probably damaging	Het
Cd2ap	T	A	17: 42,816,089		probably null	Het
Clip1	T	A	5: 123,590,834	E1155D	probably damaging	Het
Cnnm2	A	G	19: 46,877,936	E841G	probably damaging	Het
Cntrl	G	A	2: 35,120,049	R245H	probably damaging	Het
Cyp2b23	A	T	7: 26,681,417	S128T	probably benign	Het
Dhrs11	A	T	11: 84,821,753	I196N	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Edc3	A	T	9: 57,748,403	I479F	possibly damaging	Het
Emg1	T	A	6: 124,705,046	M172L	probably benign	Het
Epha7	G	A	4: 28,938,680	V512I	probably benign	Het
Exoc7	T	C	11: 116,306,905	D27G	probably benign	Het
Flg	A	T	3: 93,280,000	H253L	probably benign	Het
Fnip2	A	T	3: 79,479,505	D971E	possibly damaging	Het
Gab2	A	G	7: 97,299,073	Y290C	probably damaging	Het
Gm17067	T	A	7: 42,710,680	I43L	possibly damaging	Het
Gpld1	A	G	13: 24,962,322	Y183C	probably damaging	Het
Gpr137c	C	A	14: 45,278,935	P327T	probably benign	Het
Hepacam2	A	G	6: 3,494,477	M1T	probably null	Het
Ighv5-4	A	T	12: 113,597,440		probably benign	Het
Itgb8	T	A	12: 119,168,005	E635V	possibly damaging	Het
Kat14	T	C	2: 144,404,062	V469A	probably damaging	Het
Kcnj15	C	T	16: 95,296,470	T317I	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl18	A	T	9: 110,436,083	L285Q	probably damaging	Het
Krt90	G	A	15: 101,562,783	R15W	probably damaging	Het
Krtap4-8	A	T	11: 99,780,037	C203S	unknown	Het
Lsp1	C	T	7: 142,486,361	S75F	probably damaging	Het
Map1b	A	G	13: 99,431,072	S1714P	unknown	Het
Mcm2	A	G	6: 88,888,252	I481T	probably damaging	Het
Mcpt9	T	C	14: 56,027,679	T122A	probably benign	Het
Megf10	A	T	18: 57,289,393	R947W	probably damaging	Het
Olfr632	A	T	7: 103,937,409	N10Y	possibly damaging	Het
Olfr700	A	T	7: 106,805,865	V199D	probably damaging	Het
Pank4	A	G	4: 154,969,601	Y79C	probably damaging	Het
Pds5b	T	A	5: 150,746,706	N386K	probably benign	Het
Pfkm	A	G	15: 98,125,047	M362V	probably benign	Het
Phc2	T	C	4: 128,743,558		probably null	Het
Pou4f1	C	T	14: 104,466,175	A274T	unknown	Het
Proc	A	G	18: 32,123,705	L303P	probably damaging	Het
Ptk2b	C	T	14: 66,157,068	G821D	possibly damaging	Het
Rlim	T	C	X: 103,962,661	T545A	probably benign	Het
Serpinb6c	T	C	13: 33,893,905	N161D	probably benign	Het
Sf3b1	G	A	1: 55,019,389	Q14*	probably null	Het
Sh3d19	G	A	3: 86,107,227	V442M	possibly damaging	Het
Slc30a8	A	G	15: 52,321,701	I140V	probably benign	Het
Spata1	T	A	3: 146,475,324	N293I	probably damaging	Het
Strap	T	G	6: 137,735,382	C10G	probably damaging	Het
Tcf7	C	A	11: 52,282,966		probably benign	Het
Tmem114	A	T	16: 8,412,190	M116K	probably damaging	Het
Tmem63b	A	G	17: 45,677,958	S113P	probably damaging	Het
Tmtc3	A	C	10: 100,449,026	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,256,182		probably benign	Het
Tns2	T	C	15: 102,113,837		probably null	Het
Trim30a	A	G	7: 104,411,141	V476A	probably damaging	Het
Ush2a	T	A	1: 188,399,954	V791D	probably benign	Het
Vmn2r99	T	C	17: 19,394,373	F785S	possibly damaging	Het
Wdr35	A	T	12: 8,986,077	I283F	probably benign	Het
Wnt10b	G	T	15: 98,774,338	A166E	possibly damaging	Het

Other mutations in Fasl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01305:Fasl	APN	1	161781838	missense	probably damaging	0.99
IGL01510:Fasl	APN	1	161781953	missense	possibly damaging	0.50
riogrande	UTSW	1	161788164	missense	probably benign
riogrande2	UTSW	1	161787138	missense	probably benign	0.00
ANU22:Fasl	UTSW	1	161781838	missense	probably damaging	0.99
R0012:Fasl	UTSW	1	161788164	missense	probably benign
R0454:Fasl	UTSW	1	161787954	missense	probably benign	0.16
R2167:Fasl	UTSW	1	161787138	missense	probably benign	0.00
R3794:Fasl	UTSW	1	161781737	missense	probably benign	0.16
R4082:Fasl	UTSW	1	161781851	missense	probably damaging	1.00
R4596:Fasl	UTSW	1	161788269	missense	probably benign	0.31
R4622:Fasl	UTSW	1	161787134	missense	probably benign	0.00
R6785:Fasl	UTSW	1	161781835	missense	probably benign	0.10
R6969:Fasl	UTSW	1	161781675	missense	probably damaging	0.98
R7248:Fasl	UTSW	1	161788191	missense	possibly damaging	0.90
R7336:Fasl	UTSW	1	161787988	missense	probably damaging	1.00
R8135:Fasl	UTSW	1	161787128	missense	probably benign
R9322:Fasl	UTSW	1	161781943	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTCCTTCTGCAGGTGGAAG -3'
(R):5'- AGAGTTCTGTCCTTGACACCTG -3'

Sequencing Primer
(F):5'- GGAAGAGCTGATACATTCCTAATCC -3'
(R):5'- TGAGTCTCCTCCACAAGGCTG -3'

Posted On

2015-04-17