Incidental Mutation 'R3911:Fasl'
ID309360
Institutional Source Beutler Lab
Gene Symbol Fasl
Ensembl Gene ENSMUSG00000000817
Gene NameFas ligand (TNF superfamily, member 6)
SynonymsAPT1LG1, CD178, CD95L, Fas-L, Tnfsf6
MMRRC Submission 040909-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R3911 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161780689-161788495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 161788191 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 32 (C32F)
Ref Sequence ENSEMBL: ENSMUSP00000000834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000834] [ENSMUST00000193648]
Predicted Effect probably benign
Transcript: ENSMUST00000000834
AA Change: C32F

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000000834
Gene: ENSMUSG00000000817
AA Change: C32F

DomainStartEndE-ValueType
low complexity region 45 70 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
TNF 143 279 2.29e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193648
SMART Domains Protein: ENSMUSP00000141422
Gene: ENSMUSG00000000817

DomainStartEndE-ValueType
Pfam:TNF 1 69 2.3e-15 PFAM
Meta Mutation Damage Score 0.1383 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a spontaneous allele, knock-out allele, or allele producting only the soluble isoform exhibit premature death due to the development of systemic lupus erythematosus, autoimmune glomerulonephritis, hepatomegaly, lymphadenopathy, and hypergammaglobulinaemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Abcb9 T A 5: 124,089,846 I111F probably benign Het
Abcc12 A C 8: 86,528,419 probably benign Het
Adgre1 G T 17: 57,447,860 V653L probably damaging Het
Aebp2 T A 6: 140,647,981 D230E probably damaging Het
Asap3 A G 4: 136,229,457 probably benign Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Casp8 A T 1: 58,833,705 S267C probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Cd2ap T A 17: 42,816,089 probably null Het
Clip1 T A 5: 123,590,834 E1155D probably damaging Het
Cnnm2 A G 19: 46,877,936 E841G probably damaging Het
Cntrl G A 2: 35,120,049 R245H probably damaging Het
Cyp2b23 A T 7: 26,681,417 S128T probably benign Het
Dhrs11 A T 11: 84,821,753 I196N probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Edc3 A T 9: 57,748,403 I479F possibly damaging Het
Emg1 T A 6: 124,705,046 M172L probably benign Het
Epha7 G A 4: 28,938,680 V512I probably benign Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Flg A T 3: 93,280,000 H253L probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm17067 T A 7: 42,710,680 I43L possibly damaging Het
Gpld1 A G 13: 24,962,322 Y183C probably damaging Het
Gpr137c C A 14: 45,278,935 P327T probably benign Het
Hepacam2 A G 6: 3,494,477 M1T probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Itgb8 T A 12: 119,168,005 E635V possibly damaging Het
Kat14 T C 2: 144,404,062 V469A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A T 9: 110,436,083 L285Q probably damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Krtap4-8 A T 11: 99,780,037 C203S unknown Het
Lsp1 C T 7: 142,486,361 S75F probably damaging Het
Map1b A G 13: 99,431,072 S1714P unknown Het
Mcm2 A G 6: 88,888,252 I481T probably damaging Het
Mcpt9 T C 14: 56,027,679 T122A probably benign Het
Megf10 A T 18: 57,289,393 R947W probably damaging Het
Olfr632 A T 7: 103,937,409 N10Y possibly damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Pank4 A G 4: 154,969,601 Y79C probably damaging Het
Pds5b T A 5: 150,746,706 N386K probably benign Het
Pfkm A G 15: 98,125,047 M362V probably benign Het
Phc2 T C 4: 128,743,558 probably null Het
Pou4f1 C T 14: 104,466,175 A274T unknown Het
Proc A G 18: 32,123,705 L303P probably damaging Het
Ptk2b C T 14: 66,157,068 G821D possibly damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Serpinb6c T C 13: 33,893,905 N161D probably benign Het
Sf3b1 G A 1: 55,019,389 Q14* probably null Het
Sh3d19 G A 3: 86,107,227 V442M possibly damaging Het
Slc30a8 A G 15: 52,321,701 I140V probably benign Het
Spata1 T A 3: 146,475,324 N293I probably damaging Het
Strap T G 6: 137,735,382 C10G probably damaging Het
Tcf7 C A 11: 52,282,966 probably benign Het
Tmem114 A T 16: 8,412,190 M116K probably damaging Het
Tmem63b A G 17: 45,677,958 S113P probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Tns2 T C 15: 102,113,837 probably null Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ush2a T A 1: 188,399,954 V791D probably benign Het
Vmn2r99 T C 17: 19,394,373 F785S possibly damaging Het
Wdr35 A T 12: 8,986,077 I283F probably benign Het
Wnt10b G T 15: 98,774,338 A166E possibly damaging Het
Other mutations in Fasl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Fasl APN 1 161781838 missense probably damaging 0.99
IGL01510:Fasl APN 1 161781953 missense possibly damaging 0.50
riogrande UTSW 1 161788164 missense probably benign
riogrande2 UTSW 1 161787138 missense probably benign 0.00
ANU22:Fasl UTSW 1 161781838 missense probably damaging 0.99
R0012:Fasl UTSW 1 161788164 missense probably benign
R0454:Fasl UTSW 1 161787954 missense probably benign 0.16
R2167:Fasl UTSW 1 161787138 missense probably benign 0.00
R3794:Fasl UTSW 1 161781737 missense probably benign 0.16
R4082:Fasl UTSW 1 161781851 missense probably damaging 1.00
R4596:Fasl UTSW 1 161788269 missense probably benign 0.31
R4622:Fasl UTSW 1 161787134 missense probably benign 0.00
R6785:Fasl UTSW 1 161781835 missense probably benign 0.10
R6969:Fasl UTSW 1 161781675 missense probably damaging 0.98
R7248:Fasl UTSW 1 161788191 missense possibly damaging 0.90
R7336:Fasl UTSW 1 161787988 missense probably damaging 1.00
R8135:Fasl UTSW 1 161787128 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTCCTTCTGCAGGTGGAAG -3'
(R):5'- AGAGTTCTGTCCTTGACACCTG -3'

Sequencing Primer
(F):5'- GGAAGAGCTGATACATTCCTAATCC -3'
(R):5'- TGAGTCTCCTCCACAAGGCTG -3'
Posted On2015-04-17