Incidental Mutation 'R3911:Spata1'
ID309370
Institutional Source Beutler Lab
Gene Symbol Spata1
Ensembl Gene ENSMUSG00000028188
Gene Namespermatogenesis associated 1
SynonymsSP-2, 4921536I21Rik
MMRRC Submission 040909-MU
Accession Numbers

Genbank: NM_027617

Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R3911 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146457196-146499753 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146475324 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 293 (N293I)
Ref Sequence ENSEMBL: ENSMUSP00000142800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029839] [ENSMUST00000195949] [ENSMUST00000197980]
Predicted Effect probably damaging
Transcript: ENSMUST00000029839
AA Change: N293I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029839
Gene: ENSMUSG00000028188
AA Change: N293I

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:SPATA1_C 279 428 1.7e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123421
Predicted Effect probably benign
Transcript: ENSMUST00000195949
SMART Domains Protein: ENSMUSP00000143495
Gene: ENSMUSG00000028188

DomainStartEndE-ValueType
Pfam:SPATA1_C 11 137 1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197684
Predicted Effect probably damaging
Transcript: ENSMUST00000197980
AA Change: N293I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142800
Gene: ENSMUSG00000028188
AA Change: N293I

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
SCOP:d1eq1a_ 267 365 8e-5 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Abcb9 T A 5: 124,089,846 I111F probably benign Het
Abcc12 A C 8: 86,528,419 probably benign Het
Adgre1 G T 17: 57,447,860 V653L probably damaging Het
Aebp2 T A 6: 140,647,981 D230E probably damaging Het
Asap3 A G 4: 136,229,457 probably benign Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Casp8 A T 1: 58,833,705 S267C probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Cd2ap T A 17: 42,816,089 probably null Het
Clip1 T A 5: 123,590,834 E1155D probably damaging Het
Cnnm2 A G 19: 46,877,936 E841G probably damaging Het
Cntrl G A 2: 35,120,049 R245H probably damaging Het
Cyp2b23 A T 7: 26,681,417 S128T probably benign Het
Dhrs11 A T 11: 84,821,753 I196N probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Edc3 A T 9: 57,748,403 I479F possibly damaging Het
Emg1 T A 6: 124,705,046 M172L probably benign Het
Epha7 G A 4: 28,938,680 V512I probably benign Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Fasl C A 1: 161,788,191 C32F probably benign Het
Flg A T 3: 93,280,000 H253L probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm17067 T A 7: 42,710,680 I43L possibly damaging Het
Gpld1 A G 13: 24,962,322 Y183C probably damaging Het
Gpr137c C A 14: 45,278,935 P327T probably benign Het
Hepacam2 A G 6: 3,494,477 M1T probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Itgb8 T A 12: 119,168,005 E635V possibly damaging Het
Kat14 T C 2: 144,404,062 V469A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A T 9: 110,436,083 L285Q probably damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Krtap4-8 A T 11: 99,780,037 C203S unknown Het
Lsp1 C T 7: 142,486,361 S75F probably damaging Het
Map1b A G 13: 99,431,072 S1714P unknown Het
Mcm2 A G 6: 88,888,252 I481T probably damaging Het
Mcpt9 T C 14: 56,027,679 T122A probably benign Het
Megf10 A T 18: 57,289,393 R947W probably damaging Het
Olfr632 A T 7: 103,937,409 N10Y possibly damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Pank4 A G 4: 154,969,601 Y79C probably damaging Het
Pds5b T A 5: 150,746,706 N386K probably benign Het
Pfkm A G 15: 98,125,047 M362V probably benign Het
Phc2 T C 4: 128,743,558 probably null Het
Pou4f1 C T 14: 104,466,175 A274T unknown Het
Proc A G 18: 32,123,705 L303P probably damaging Het
Ptk2b C T 14: 66,157,068 G821D possibly damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Serpinb6c T C 13: 33,893,905 N161D probably benign Het
Sf3b1 G A 1: 55,019,389 Q14* probably null Het
Sh3d19 G A 3: 86,107,227 V442M possibly damaging Het
Slc30a8 A G 15: 52,321,701 I140V probably benign Het
Strap T G 6: 137,735,382 C10G probably damaging Het
Tcf7 C A 11: 52,282,966 probably benign Het
Tmem114 A T 16: 8,412,190 M116K probably damaging Het
Tmem63b A G 17: 45,677,958 S113P probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Tns2 T C 15: 102,113,837 probably null Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ush2a T A 1: 188,399,954 V791D probably benign Het
Vmn2r99 T C 17: 19,394,373 F785S possibly damaging Het
Wdr35 A T 12: 8,986,077 I283F probably benign Het
Wnt10b G T 15: 98,774,338 A166E possibly damaging Het
Other mutations in Spata1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Spata1 APN 3 146476242 missense possibly damaging 0.94
IGL01306:Spata1 APN 3 146487399 nonsense probably null
IGL01537:Spata1 APN 3 146489803 splice site probably benign
IGL02363:Spata1 APN 3 146487364 missense possibly damaging 0.96
IGL02873:Spata1 APN 3 146487367 missense possibly damaging 0.86
IGL02898:Spata1 APN 3 146475339 missense possibly damaging 0.71
IGL03071:Spata1 APN 3 146475334 missense possibly damaging 0.93
IGL03204:Spata1 APN 3 146488679 missense probably benign 0.18
ANU23:Spata1 UTSW 3 146487399 nonsense probably null
H8930:Spata1 UTSW 3 146487271 nonsense probably null
R0414:Spata1 UTSW 3 146476188 splice site probably null
R1109:Spata1 UTSW 3 146475298 missense possibly damaging 0.51
R1742:Spata1 UTSW 3 146469623 critical splice donor site probably null
R1816:Spata1 UTSW 3 146481207 missense probably damaging 0.98
R2006:Spata1 UTSW 3 146493683 missense probably benign 0.18
R2851:Spata1 UTSW 3 146487540 missense possibly damaging 0.96
R2852:Spata1 UTSW 3 146487540 missense possibly damaging 0.96
R3416:Spata1 UTSW 3 146487508 splice site probably benign
R4856:Spata1 UTSW 3 146469774 missense probably damaging 0.99
R4859:Spata1 UTSW 3 146469774 missense probably damaging 0.99
R4886:Spata1 UTSW 3 146469774 missense probably damaging 0.99
R6902:Spata1 UTSW 3 146475323 missense possibly damaging 0.77
R7459:Spata1 UTSW 3 146476222 missense possibly damaging 0.86
R7532:Spata1 UTSW 3 146468191 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGGTCTGTAGGAAACAAGTTGAATG -3'
(R):5'- CTCCATGGTGGTAAGAGCAG -3'

Sequencing Primer
(F):5'- GAATGACTGTGTTTTCTATACTGAGC -3'
(R):5'- GAGCAGAAAGAAAAACATGGTTTG -3'
Posted On2015-04-17