Incidental Mutation 'R3911:Pds5b'
ID 309380
Institutional Source Beutler Lab
Gene Symbol Pds5b
Ensembl Gene ENSMUSG00000034021
Gene Name PDS5 cohesin associated factor B
Synonyms Aprin, AS3
MMRRC Submission 040909-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3911 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 150673739-150810690 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150746706 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 386 (N386K)
Ref Sequence ENSEMBL: ENSMUSP00000144572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000202170]
AlphaFold Q4VA53
Predicted Effect probably benign
Transcript: ENSMUST00000016569
AA Change: N386K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: N386K

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1247 1259 4.14e1 SMART
AT_hook 1285 1297 1.35e2 SMART
low complexity region 1307 1316 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
AT_hook 1370 1382 1.46e0 SMART
low complexity region 1437 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038900
AA Change: N386K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: N386K

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1373 1385 1.46e0 SMART
low complexity region 1440 1449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133738
Predicted Effect probably benign
Transcript: ENSMUST00000202170
AA Change: N386K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: N386K

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1372 1384 1.46e0 SMART
low complexity region 1439 1448 N/A INTRINSIC
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Abcb9 T A 5: 124,089,846 I111F probably benign Het
Abcc12 A C 8: 86,528,419 probably benign Het
Adgre1 G T 17: 57,447,860 V653L probably damaging Het
Aebp2 T A 6: 140,647,981 D230E probably damaging Het
Asap3 A G 4: 136,229,457 probably benign Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Casp8 A T 1: 58,833,705 S267C probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Cd2ap T A 17: 42,816,089 probably null Het
Clip1 T A 5: 123,590,834 E1155D probably damaging Het
Cnnm2 A G 19: 46,877,936 E841G probably damaging Het
Cntrl G A 2: 35,120,049 R245H probably damaging Het
Cyp2b23 A T 7: 26,681,417 S128T probably benign Het
Dhrs11 A T 11: 84,821,753 I196N probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Edc3 A T 9: 57,748,403 I479F possibly damaging Het
Emg1 T A 6: 124,705,046 M172L probably benign Het
Epha7 G A 4: 28,938,680 V512I probably benign Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Fasl C A 1: 161,788,191 C32F probably benign Het
Flg A T 3: 93,280,000 H253L probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm17067 T A 7: 42,710,680 I43L possibly damaging Het
Gpld1 A G 13: 24,962,322 Y183C probably damaging Het
Gpr137c C A 14: 45,278,935 P327T probably benign Het
Hepacam2 A G 6: 3,494,477 M1T probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Itgb8 T A 12: 119,168,005 E635V possibly damaging Het
Kat14 T C 2: 144,404,062 V469A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A T 9: 110,436,083 L285Q probably damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Krtap4-8 A T 11: 99,780,037 C203S unknown Het
Lsp1 C T 7: 142,486,361 S75F probably damaging Het
Map1b A G 13: 99,431,072 S1714P unknown Het
Mcm2 A G 6: 88,888,252 I481T probably damaging Het
Mcpt9 T C 14: 56,027,679 T122A probably benign Het
Megf10 A T 18: 57,289,393 R947W probably damaging Het
Olfr632 A T 7: 103,937,409 N10Y possibly damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Pank4 A G 4: 154,969,601 Y79C probably damaging Het
Pfkm A G 15: 98,125,047 M362V probably benign Het
Phc2 T C 4: 128,743,558 probably null Het
Pou4f1 C T 14: 104,466,175 A274T unknown Het
Proc A G 18: 32,123,705 L303P probably damaging Het
Ptk2b C T 14: 66,157,068 G821D possibly damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Serpinb6c T C 13: 33,893,905 N161D probably benign Het
Sf3b1 G A 1: 55,019,389 Q14* probably null Het
Sh3d19 G A 3: 86,107,227 V442M possibly damaging Het
Slc30a8 A G 15: 52,321,701 I140V probably benign Het
Spata1 T A 3: 146,475,324 N293I probably damaging Het
Strap T G 6: 137,735,382 C10G probably damaging Het
Tcf7 C A 11: 52,282,966 probably benign Het
Tmem114 A T 16: 8,412,190 M116K probably damaging Het
Tmem63b A G 17: 45,677,958 S113P probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Tns2 T C 15: 102,113,837 probably null Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ush2a T A 1: 188,399,954 V791D probably benign Het
Vmn2r99 T C 17: 19,394,373 F785S possibly damaging Het
Wdr35 A T 12: 8,986,077 I283F probably benign Het
Wnt10b G T 15: 98,774,338 A166E possibly damaging Het
Other mutations in Pds5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Pds5b APN 5 150722542 missense probably benign 0.25
IGL01530:Pds5b APN 5 150792175 missense probably benign 0.38
IGL01812:Pds5b APN 5 150780689 missense probably damaging 1.00
IGL02163:Pds5b APN 5 150756406 missense probably benign 0.00
IGL02730:Pds5b APN 5 150780752 splice site probably benign
IGL02825:Pds5b APN 5 150728970 missense possibly damaging 0.90
IGL03143:Pds5b APN 5 150779257 missense probably damaging 1.00
IGL03379:Pds5b APN 5 150788331 missense probably damaging 1.00
PIT4283001:Pds5b UTSW 5 150778309 missense probably damaging 0.99
R0026:Pds5b UTSW 5 150749830 splice site probably benign
R0197:Pds5b UTSW 5 150754431 missense probably benign 0.28
R0347:Pds5b UTSW 5 150736427 splice site probably benign
R0396:Pds5b UTSW 5 150779275 missense possibly damaging 0.96
R0400:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R0442:Pds5b UTSW 5 150716544 splice site probably benign
R0745:Pds5b UTSW 5 150805671 missense probably benign
R0839:Pds5b UTSW 5 150764962 missense probably benign 0.23
R0866:Pds5b UTSW 5 150739191 splice site probably benign
R1247:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R1330:Pds5b UTSW 5 150761077 missense probably damaging 0.97
R1440:Pds5b UTSW 5 150754417 missense probably damaging 1.00
R1526:Pds5b UTSW 5 150716400 splice site probably null
R2010:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R2051:Pds5b UTSW 5 150748190 missense probably damaging 1.00
R2507:Pds5b UTSW 5 150756428 missense possibly damaging 0.90
R3111:Pds5b UTSW 5 150719907 missense probably damaging 1.00
R3820:Pds5b UTSW 5 150736337 missense possibly damaging 0.94
R4077:Pds5b UTSW 5 150794359 missense possibly damaging 0.62
R4118:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R4342:Pds5b UTSW 5 150800854 missense probably benign 0.17
R4416:Pds5b UTSW 5 150736396 missense probably damaging 1.00
R4503:Pds5b UTSW 5 150728934 missense probably damaging 1.00
R4524:Pds5b UTSW 5 150788316 missense probably damaging 1.00
R4579:Pds5b UTSW 5 150746732 missense probably damaging 0.98
R4623:Pds5b UTSW 5 150800601 missense probably benign 0.37
R4847:Pds5b UTSW 5 150748112 missense probably damaging 1.00
R4885:Pds5b UTSW 5 150716462 missense probably benign 0.21
R5271:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R5281:Pds5b UTSW 5 150746608 missense probably benign 0.26
R5337:Pds5b UTSW 5 150793597 missense probably benign 0.03
R5635:Pds5b UTSW 5 150778221 missense possibly damaging 0.78
R5677:Pds5b UTSW 5 150716461 missense possibly damaging 0.91
R6005:Pds5b UTSW 5 150769776 splice site probably null
R6139:Pds5b UTSW 5 150800777 missense possibly damaging 0.81
R6225:Pds5b UTSW 5 150746618 missense probably damaging 0.98
R6279:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6300:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6666:Pds5b UTSW 5 150778166 missense probably damaging 1.00
R6805:Pds5b UTSW 5 150805561 splice site probably null
R7038:Pds5b UTSW 5 150800760 missense probably benign 0.02
R7046:Pds5b UTSW 5 150749920 missense probably damaging 1.00
R7051:Pds5b UTSW 5 150794282 missense possibly damaging 0.78
R7138:Pds5b UTSW 5 150800677 nonsense probably null
R7255:Pds5b UTSW 5 150796667 missense probably benign 0.33
R7467:Pds5b UTSW 5 150736327 missense probably damaging 0.99
R7488:Pds5b UTSW 5 150723337 missense probably damaging 0.97
R7512:Pds5b UTSW 5 150788342 missense probably damaging 1.00
R7561:Pds5b UTSW 5 150739318 critical splice donor site probably null
R7576:Pds5b UTSW 5 150778261 missense probably damaging 1.00
R7889:Pds5b UTSW 5 150792172 missense probably damaging 1.00
R7982:Pds5b UTSW 5 150769941 missense probably damaging 1.00
R8059:Pds5b UTSW 5 150807835 missense unknown
R8211:Pds5b UTSW 5 150728942 missense possibly damaging 0.90
R8412:Pds5b UTSW 5 150719959 missense probably damaging 1.00
R8503:Pds5b UTSW 5 150716507 missense possibly damaging 0.95
R8556:Pds5b UTSW 5 150792608 missense probably benign
R8786:Pds5b UTSW 5 150780669 missense probably damaging 1.00
R8929:Pds5b UTSW 5 150719914 missense probably damaging 1.00
R8985:Pds5b UTSW 5 150800774 missense probably benign 0.38
R9184:Pds5b UTSW 5 150800784 missense probably benign 0.04
R9343:Pds5b UTSW 5 150780721 missense probably damaging 1.00
R9432:Pds5b UTSW 5 150769791 missense probably damaging 1.00
R9571:Pds5b UTSW 5 150722506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCCCCACTCCTAGCCT -3'
(R):5'- TCAGGGCTAGCCTAGAATACAGA -3'

Sequencing Primer
(F):5'- GTAGTCCTGACTGTCCTGGAAC -3'
(R):5'- TAGCCTAGAATACAGAGAGAATTCC -3'
Posted On 2015-04-17