Incidental Mutation 'R3911:Olfr700'
ID309392
Institutional Source Beutler Lab
Gene Symbol Olfr700
Ensembl Gene ENSMUSG00000094493
Gene Nameolfactory receptor 700
SynonymsGA_x6K02T2PBJ9-9184187-9183237, MOR283-4
MMRRC Submission 040909-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3911 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106805395-106808834 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106805865 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 199 (V199D)
Ref Sequence ENSEMBL: ENSMUSP00000150320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079936] [ENSMUST00000214840]
Predicted Effect probably damaging
Transcript: ENSMUST00000079936
AA Change: V199D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078855
Gene: ENSMUSG00000094493
AA Change: V199D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.6e-5 PFAM
Pfam:7tm_1 41 290 3.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209339
Predicted Effect probably damaging
Transcript: ENSMUST00000214840
AA Change: V199D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Abcb9 T A 5: 124,089,846 I111F probably benign Het
Abcc12 A C 8: 86,528,419 probably benign Het
Adgre1 G T 17: 57,447,860 V653L probably damaging Het
Aebp2 T A 6: 140,647,981 D230E probably damaging Het
Asap3 A G 4: 136,229,457 probably benign Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Casp8 A T 1: 58,833,705 S267C probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Cd2ap T A 17: 42,816,089 probably null Het
Clip1 T A 5: 123,590,834 E1155D probably damaging Het
Cnnm2 A G 19: 46,877,936 E841G probably damaging Het
Cntrl G A 2: 35,120,049 R245H probably damaging Het
Cyp2b23 A T 7: 26,681,417 S128T probably benign Het
Dhrs11 A T 11: 84,821,753 I196N probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Edc3 A T 9: 57,748,403 I479F possibly damaging Het
Emg1 T A 6: 124,705,046 M172L probably benign Het
Epha7 G A 4: 28,938,680 V512I probably benign Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Fasl C A 1: 161,788,191 C32F probably benign Het
Flg A T 3: 93,280,000 H253L probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm17067 T A 7: 42,710,680 I43L possibly damaging Het
Gpld1 A G 13: 24,962,322 Y183C probably damaging Het
Gpr137c C A 14: 45,278,935 P327T probably benign Het
Hepacam2 A G 6: 3,494,477 M1T probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Itgb8 T A 12: 119,168,005 E635V possibly damaging Het
Kat14 T C 2: 144,404,062 V469A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A T 9: 110,436,083 L285Q probably damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Krtap4-8 A T 11: 99,780,037 C203S unknown Het
Lsp1 C T 7: 142,486,361 S75F probably damaging Het
Map1b A G 13: 99,431,072 S1714P unknown Het
Mcm2 A G 6: 88,888,252 I481T probably damaging Het
Mcpt9 T C 14: 56,027,679 T122A probably benign Het
Megf10 A T 18: 57,289,393 R947W probably damaging Het
Olfr632 A T 7: 103,937,409 N10Y possibly damaging Het
Pank4 A G 4: 154,969,601 Y79C probably damaging Het
Pds5b T A 5: 150,746,706 N386K probably benign Het
Pfkm A G 15: 98,125,047 M362V probably benign Het
Phc2 T C 4: 128,743,558 probably null Het
Pou4f1 C T 14: 104,466,175 A274T unknown Het
Proc A G 18: 32,123,705 L303P probably damaging Het
Ptk2b C T 14: 66,157,068 G821D possibly damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Serpinb6c T C 13: 33,893,905 N161D probably benign Het
Sf3b1 G A 1: 55,019,389 Q14* probably null Het
Sh3d19 G A 3: 86,107,227 V442M possibly damaging Het
Slc30a8 A G 15: 52,321,701 I140V probably benign Het
Spata1 T A 3: 146,475,324 N293I probably damaging Het
Strap T G 6: 137,735,382 C10G probably damaging Het
Tcf7 C A 11: 52,282,966 probably benign Het
Tmem114 A T 16: 8,412,190 M116K probably damaging Het
Tmem63b A G 17: 45,677,958 S113P probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Tns2 T C 15: 102,113,837 probably null Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ush2a T A 1: 188,399,954 V791D probably benign Het
Vmn2r99 T C 17: 19,394,373 F785S possibly damaging Het
Wdr35 A T 12: 8,986,077 I283F probably benign Het
Wnt10b G T 15: 98,774,338 A166E possibly damaging Het
Other mutations in Olfr700
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Olfr700 APN 7 106806435 missense probably benign 0.03
IGL01474:Olfr700 APN 7 106805940 missense probably benign 0.23
IGL01720:Olfr700 APN 7 106806209 missense probably damaging 0.99
R0501:Olfr700 UTSW 7 106805811 missense probably damaging 1.00
R2061:Olfr700 UTSW 7 106805768 missense probably benign 0.00
R2511:Olfr700 UTSW 7 106805961 missense probably damaging 1.00
R2876:Olfr700 UTSW 7 106805997 missense probably benign 0.00
R3816:Olfr700 UTSW 7 106805820 missense probably damaging 1.00
R3910:Olfr700 UTSW 7 106805865 missense probably damaging 1.00
R3912:Olfr700 UTSW 7 106805865 missense probably damaging 1.00
R4855:Olfr700 UTSW 7 106806256 missense probably benign 0.01
R4864:Olfr700 UTSW 7 106805964 missense probably damaging 1.00
R5101:Olfr700 UTSW 7 106806213 missense possibly damaging 0.53
R5335:Olfr700 UTSW 7 106805734 missense probably damaging 1.00
R6217:Olfr700 UTSW 7 106806072 missense probably damaging 1.00
R6880:Olfr700 UTSW 7 106805812 missense probably damaging 1.00
R7522:Olfr700 UTSW 7 106805787 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGAGCTGGGGTGACAATTG -3'
(R):5'- ACCTAGGATCTGCTGGCTTG -3'

Sequencing Primer
(F):5'- CTGGGGTGACAATTGTGTAGAAAAC -3'
(R):5'- GGAGTGTTCATATCATGGACCC -3'
Posted On2015-04-17