Mutagenetix > Incidental Mutation

Incidental Mutation 'R3911:Map1b'

309409

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

040909-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3911 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 99431072 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1714 (S1714P)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: S1714P

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: S1714P

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.0897

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	A	T	5: 24,545,442		probably benign	Het
9030624J02Rik	A	G	7: 118,746,390	T49A	possibly damaging	Het
Abcb9	T	A	5: 124,089,846	I111F	probably benign	Het
Abcc12	A	C	8: 86,528,419		probably benign	Het
Adgre1	G	T	17: 57,447,860	V653L	probably damaging	Het
Aebp2	T	A	6: 140,647,981	D230E	probably damaging	Het
Asap3	A	G	4: 136,229,457		probably benign	Het
Bod1l	T	C	5: 41,817,098	E2291G	probably damaging	Het
Casp8	A	T	1: 58,833,705	S267C	probably damaging	Het
Cchcr1	T	C	17: 35,525,336	V341A	probably damaging	Het
Cd2ap	T	A	17: 42,816,089		probably null	Het
Clip1	T	A	5: 123,590,834	E1155D	probably damaging	Het
Cnnm2	A	G	19: 46,877,936	E841G	probably damaging	Het
Cntrl	G	A	2: 35,120,049	R245H	probably damaging	Het
Cyp2b23	A	T	7: 26,681,417	S128T	probably benign	Het
Dhrs11	A	T	11: 84,821,753	I196N	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Edc3	A	T	9: 57,748,403	I479F	possibly damaging	Het
Emg1	T	A	6: 124,705,046	M172L	probably benign	Het
Epha7	G	A	4: 28,938,680	V512I	probably benign	Het
Exoc7	T	C	11: 116,306,905	D27G	probably benign	Het
Fasl	C	A	1: 161,788,191	C32F	probably benign	Het
Flg	A	T	3: 93,280,000	H253L	probably benign	Het
Fnip2	A	T	3: 79,479,505	D971E	possibly damaging	Het
Gab2	A	G	7: 97,299,073	Y290C	probably damaging	Het
Gm17067	T	A	7: 42,710,680	I43L	possibly damaging	Het
Gpld1	A	G	13: 24,962,322	Y183C	probably damaging	Het
Gpr137c	C	A	14: 45,278,935	P327T	probably benign	Het
Hepacam2	A	G	6: 3,494,477	M1T	probably null	Het
Ighv5-4	A	T	12: 113,597,440		probably benign	Het
Itgb8	T	A	12: 119,168,005	E635V	possibly damaging	Het
Kat14	T	C	2: 144,404,062	V469A	probably damaging	Het
Kcnj15	C	T	16: 95,296,470	T317I	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl18	A	T	9: 110,436,083	L285Q	probably damaging	Het
Krt90	G	A	15: 101,562,783	R15W	probably damaging	Het
Krtap4-8	A	T	11: 99,780,037	C203S	unknown	Het
Lsp1	C	T	7: 142,486,361	S75F	probably damaging	Het
Mcm2	A	G	6: 88,888,252	I481T	probably damaging	Het
Mcpt9	T	C	14: 56,027,679	T122A	probably benign	Het
Megf10	A	T	18: 57,289,393	R947W	probably damaging	Het
Olfr632	A	T	7: 103,937,409	N10Y	possibly damaging	Het
Olfr700	A	T	7: 106,805,865	V199D	probably damaging	Het
Pank4	A	G	4: 154,969,601	Y79C	probably damaging	Het
Pds5b	T	A	5: 150,746,706	N386K	probably benign	Het
Pfkm	A	G	15: 98,125,047	M362V	probably benign	Het
Phc2	T	C	4: 128,743,558		probably null	Het
Pou4f1	C	T	14: 104,466,175	A274T	unknown	Het
Proc	A	G	18: 32,123,705	L303P	probably damaging	Het
Ptk2b	C	T	14: 66,157,068	G821D	possibly damaging	Het
Rlim	T	C	X: 103,962,661	T545A	probably benign	Het
Serpinb6c	T	C	13: 33,893,905	N161D	probably benign	Het
Sf3b1	G	A	1: 55,019,389	Q14*	probably null	Het
Sh3d19	G	A	3: 86,107,227	V442M	possibly damaging	Het
Slc30a8	A	G	15: 52,321,701	I140V	probably benign	Het
Spata1	T	A	3: 146,475,324	N293I	probably damaging	Het
Strap	T	G	6: 137,735,382	C10G	probably damaging	Het
Tcf7	C	A	11: 52,282,966		probably benign	Het
Tmem114	A	T	16: 8,412,190	M116K	probably damaging	Het
Tmem63b	A	G	17: 45,677,958	S113P	probably damaging	Het
Tmtc3	A	C	10: 100,449,026	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,256,182		probably benign	Het
Tns2	T	C	15: 102,113,837		probably null	Het
Trim30a	A	G	7: 104,411,141	V476A	probably damaging	Het
Ush2a	T	A	1: 188,399,954	V791D	probably benign	Het
Vmn2r99	T	C	17: 19,394,373	F785S	possibly damaging	Het
Wdr35	A	T	12: 8,986,077	I283F	probably benign	Het
Wnt10b	G	T	15: 98,774,338	A166E	possibly damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TAAAGGTGAGGACTCTCGTGG -3'
(R):5'- CTTTAGTCGGCAGTCTCCAGATC -3'

Sequencing Primer
(F):5'- ATCAGATTTCGGAGAGAGCTTC -3'
(R):5'- AGTCTCCAGATCACCCTACTCTGG -3'

Posted On

2015-04-17