Incidental Mutation 'R3911:Vmn2r99'
ID309421
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Namevomeronasal 2, receptor 99
SynonymsEG665376
MMRRC Submission 040909-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R3911 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19361949-19401098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19394373 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 785 (F785S)
Ref Sequence ENSEMBL: ENSMUSP00000135236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000176107
AA Change: F785S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: F785S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Abcb9 T A 5: 124,089,846 I111F probably benign Het
Abcc12 A C 8: 86,528,419 probably benign Het
Adgre1 G T 17: 57,447,860 V653L probably damaging Het
Aebp2 T A 6: 140,647,981 D230E probably damaging Het
Asap3 A G 4: 136,229,457 probably benign Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Casp8 A T 1: 58,833,705 S267C probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Cd2ap T A 17: 42,816,089 probably null Het
Clip1 T A 5: 123,590,834 E1155D probably damaging Het
Cnnm2 A G 19: 46,877,936 E841G probably damaging Het
Cntrl G A 2: 35,120,049 R245H probably damaging Het
Cyp2b23 A T 7: 26,681,417 S128T probably benign Het
Dhrs11 A T 11: 84,821,753 I196N probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Edc3 A T 9: 57,748,403 I479F possibly damaging Het
Emg1 T A 6: 124,705,046 M172L probably benign Het
Epha7 G A 4: 28,938,680 V512I probably benign Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Fasl C A 1: 161,788,191 C32F probably benign Het
Flg A T 3: 93,280,000 H253L probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm17067 T A 7: 42,710,680 I43L possibly damaging Het
Gpld1 A G 13: 24,962,322 Y183C probably damaging Het
Gpr137c C A 14: 45,278,935 P327T probably benign Het
Hepacam2 A G 6: 3,494,477 M1T probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Itgb8 T A 12: 119,168,005 E635V possibly damaging Het
Kat14 T C 2: 144,404,062 V469A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A T 9: 110,436,083 L285Q probably damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Krtap4-8 A T 11: 99,780,037 C203S unknown Het
Lsp1 C T 7: 142,486,361 S75F probably damaging Het
Map1b A G 13: 99,431,072 S1714P unknown Het
Mcm2 A G 6: 88,888,252 I481T probably damaging Het
Mcpt9 T C 14: 56,027,679 T122A probably benign Het
Megf10 A T 18: 57,289,393 R947W probably damaging Het
Olfr632 A T 7: 103,937,409 N10Y possibly damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Pank4 A G 4: 154,969,601 Y79C probably damaging Het
Pds5b T A 5: 150,746,706 N386K probably benign Het
Pfkm A G 15: 98,125,047 M362V probably benign Het
Phc2 T C 4: 128,743,558 probably null Het
Pou4f1 C T 14: 104,466,175 A274T unknown Het
Proc A G 18: 32,123,705 L303P probably damaging Het
Ptk2b C T 14: 66,157,068 G821D possibly damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Serpinb6c T C 13: 33,893,905 N161D probably benign Het
Sf3b1 G A 1: 55,019,389 Q14* probably null Het
Sh3d19 G A 3: 86,107,227 V442M possibly damaging Het
Slc30a8 A G 15: 52,321,701 I140V probably benign Het
Spata1 T A 3: 146,475,324 N293I probably damaging Het
Strap T G 6: 137,735,382 C10G probably damaging Het
Tcf7 C A 11: 52,282,966 probably benign Het
Tmem114 A T 16: 8,412,190 M116K probably damaging Het
Tmem63b A G 17: 45,677,958 S113P probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Tns2 T C 15: 102,113,837 probably null Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ush2a T A 1: 188,399,954 V791D probably benign Het
Wdr35 A T 12: 8,986,077 I283F probably benign Het
Wnt10b G T 15: 98,774,338 A166E possibly damaging Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19378854 missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19394256 missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19382623 missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19393658 splice site probably benign
IGL01769:Vmn2r99 APN 17 19380115 missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19380232 missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19378690 nonsense probably null
IGL03132:Vmn2r99 APN 17 19378223 nonsense probably null
FR4548:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19394343 missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19394573 missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19379043 missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19362259 missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19380060 missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19362252 missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19377945 missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19362153 missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19378815 missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19377991 missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19378629 missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19378708 missense probably damaging 0.99
R3947:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19378570 missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19379260 missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19393662 missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19362135 start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19378606 missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19379339 missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19379269 missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19394146 nonsense probably null
R6021:Vmn2r99 UTSW 17 19377948 missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19378980 missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19382605 missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19380031 missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19380034 missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19380195 missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19378110 missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19394564 nonsense probably null
R7090:Vmn2r99 UTSW 17 19393710 missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19379311 missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19379145 missense probably benign 0.01
Z1088:Vmn2r99 UTSW 17 19379301 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGGGCATATCATCATTTTGTGC -3'
(R):5'- GGAATTGAGCCATCAGGTCTAAG -3'

Sequencing Primer
(F):5'- CATTTTGTGCAACAAGGGCTCAG -3'
(R):5'- TTGAGCCATCAGGTCTAAGACTCAG -3'
Posted On2015-04-17