Mutagenetix > Incidental Mutation

Incidental Mutation 'R3912:Slc19a3'

309431

Institutional Source

Beutler Lab

Gene Symbol

Slc19a3

Ensembl Gene

ENSMUSG00000038496

Gene Name

solute carrier family 19, member 3

Synonyms

ThTr2, A230084E24Rik

MMRRC Submission

040910-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R3912 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83012523-83038448 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83022703 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 198 (M198L)

Ref Sequence

ENSEMBL: ENSMUSP00000126646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]

AlphaFold

Q99PL8

Predicted Effect

probably benign
Transcript: ENSMUST00000045560
AA Change: M198L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: M198L

Domain	Start	End	E-Value	Type
Pfam:Folate_carrier	11	435	1.4e-178	PFAM
Pfam:MFS_1	16	416	1.6e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142805

Predicted Effect

probably benign
Transcript: ENSMUST00000164473
AA Change: M198L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: M198L

Domain	Start	End	E-Value	Type
Pfam:Folate_carrier	11	435	1.3e-178	PFAM
Pfam:MFS_1	16	416	1.9e-17	PFAM

Meta Mutation Damage Score

0.2330

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	T	13: 63,156,706	E402*	probably null	Het
9030624J02Rik	A	G	7: 118,746,390	T49A	possibly damaging	Het
Acot1	A	G	12: 84,017,032	S305G	probably damaging	Het
Acot12	A	G	13: 91,770,089	D167G	probably benign	Het
Adgra1	T	C	7: 139,845,714		probably null	Het
Adh7	T	A	3: 138,221,780	V29E	probably damaging	Het
Atp2c2	A	G	8: 119,721,276	K103E	probably damaging	Het
Camkk1	A	G	11: 73,033,816	D285G	probably benign	Het
Ccdc158	G	C	5: 92,648,935	T514S	possibly damaging	Het
Cdhr5	T	A	7: 141,273,857	D210V	probably damaging	Het
Cndp1	C	T	18: 84,631,999	D190N	probably benign	Het
Eepd1	C	T	9: 25,483,304	T288M	probably damaging	Het
Erbin	G	A	13: 103,886,338		probably benign	Het
Erbin	G	T	13: 103,862,287	T197K	probably benign	Het
Fnip2	A	T	3: 79,479,505	D971E	possibly damaging	Het
Gab2	A	G	7: 97,299,073	Y290C	probably damaging	Het
Gbp3	C	T	3: 142,566,338		probably benign	Het
Gm14326	T	C	2: 177,945,865	K446R	probably damaging	Het
Gm5724	A	G	6: 141,727,636	F392S	probably damaging	Het
Herc2	T	C	7: 56,098,437	Y518H	probably damaging	Het
Id2	T	A	12: 25,095,872	K47*	probably null	Het
Ilf2	A	G	3: 90,487,060	N295S	probably benign	Het
Ilf3	C	T	9: 21,398,126	A526V	possibly damaging	Het
Ints10	T	A	8: 68,813,620	S478T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc7	G	A	3: 158,291,952	L158F	probably damaging	Het
Mroh9	C	T	1: 163,066,069	C179Y	probably damaging	Het
Mrps18b	C	T	17: 35,910,939	V165I	probably benign	Het
Myrip	A	G	9: 120,432,616	S432G	probably benign	Het
Nutm2	C	T	13: 50,472,940	A377V	possibly damaging	Het
Olfr700	A	T	7: 106,805,865	V199D	probably damaging	Het
Pate4	C	A	9: 35,611,844	M1I	probably null	Het
Pax7	C	A	4: 139,780,898	W272L	probably benign	Het
Ppp1r12b	C	T	1: 134,887,318	E320K	probably damaging	Het
Prg4	T	C	1: 150,451,868	Y278C	probably damaging	Het
Pvr	T	C	7: 19,909,292	N339D	probably benign	Het
Rev3l	A	G	10: 39,820,556	I521M	probably damaging	Het
Ryr2	A	G	13: 11,772,427	I1020T	probably damaging	Het
Scn4a	T	A	11: 106,320,716	I1492F	probably damaging	Het
Sec16a	C	T	2: 26,414,387	G2304D	probably damaging	Het
Shisa7	T	A	7: 4,830,240	R341*	probably null	Het
Slc26a8	T	A	17: 28,644,779	N669Y	possibly damaging	Het
Snap91	T	C	9: 86,792,557	T534A	possibly damaging	Het
Susd4	A	T	1: 182,887,466	Y284F	probably damaging	Het
Tas1r1	A	T	4: 152,031,924	Y418N	probably damaging	Het
Tdrd12	A	G	7: 35,487,713	I584T	probably damaging	Het
Tmtc3	A	C	10: 100,449,026	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,256,182		probably benign	Het
Trim30a	A	G	7: 104,411,141	V476A	probably damaging	Het
Vmn1r39	C	T	6: 66,805,141	M27I	probably benign	Het
Vmn2r59	T	C	7: 42,046,320	T223A	probably benign	Het
Vwa5a	T	C	9: 38,734,743	I469T	probably damaging	Het
Wnt3a	A	C	11: 59,250,002	D229E	possibly damaging	Het

Other mutations in Slc19a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03066:Slc19a3	APN	1	83014836	missense	probably damaging	0.99
tag	UTSW	1	83026260	missense	probably damaging	1.00
R0437:Slc19a3	UTSW	1	83022565	missense	probably benign	0.00
R0526:Slc19a3	UTSW	1	83022733	missense	probably damaging	1.00
R1160:Slc19a3	UTSW	1	83022692	missense	possibly damaging	0.85
R1306:Slc19a3	UTSW	1	83022762	missense	probably damaging	1.00
R1832:Slc19a3	UTSW	1	83022747	missense	probably damaging	0.99
R1938:Slc19a3	UTSW	1	83019368	missense	possibly damaging	0.76
R1961:Slc19a3	UTSW	1	83022798	missense	probably benign	0.00
R2058:Slc19a3	UTSW	1	83014791	missense	probably damaging	0.98
R2200:Slc19a3	UTSW	1	83022943	missense	probably damaging	0.96
R2245:Slc19a3	UTSW	1	83013970	missense	possibly damaging	0.84
R2261:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R2404:Slc19a3	UTSW	1	83023035	missense	probably benign	0.16
R3891:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3892:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3907:Slc19a3	UTSW	1	83014813	missense	possibly damaging	0.76
R3922:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3923:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3961:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4083:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4106:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4107:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4109:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4667:Slc19a3	UTSW	1	83022799	missense	probably benign
R4768:Slc19a3	UTSW	1	83023113	missense	probably damaging	1.00
R4769:Slc19a3	UTSW	1	83019341	missense	probably damaging	1.00
R5001:Slc19a3	UTSW	1	83022620	missense	probably benign	0.33
R5538:Slc19a3	UTSW	1	83022561	missense	possibly damaging	0.51
R5588:Slc19a3	UTSW	1	83023055	nonsense	probably null
R6143:Slc19a3	UTSW	1	83026339	missense	probably benign	0.00
R6546:Slc19a3	UTSW	1	83026360	missense	probably benign	0.02
R6547:Slc19a3	UTSW	1	83022900	missense	probably damaging	1.00
R7059:Slc19a3	UTSW	1	83022369	missense	probably damaging	1.00
R7497:Slc19a3	UTSW	1	83013928	missense	probably damaging	1.00
R7509:Slc19a3	UTSW	1	83026260	missense	probably damaging	1.00
R7584:Slc19a3	UTSW	1	83022748	missense	possibly damaging	0.79
R7810:Slc19a3	UTSW	1	83019441	missense	probably benign	0.02
R8150:Slc19a3	UTSW	1	83022495	missense	probably damaging	1.00
R8412:Slc19a3	UTSW	1	83014812	missense	probably damaging	0.97
R8970:Slc19a3	UTSW	1	83023101	missense	probably damaging	1.00
R9314:Slc19a3	UTSW	1	83022373	missense	possibly damaging	0.62
R9671:Slc19a3	UTSW	1	83022576	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTGCTTTGAGGAGTAGCAC -3'
(R):5'- AAAGTGAGCAGCTACTGTCGG -3'

Sequencing Primer
(F):5'- GAGTAGCACTCCTTCAGATCCTGG -3'
(R):5'- AGCTACTGTCGGAGTATCACACTG -3'

Posted On

2015-04-17