Incidental Mutation 'R3912:Prg4'
ID 309433
Institutional Source Beutler Lab
Gene Symbol Prg4
Ensembl Gene ENSMUSG00000006014
Gene Name proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms DOL54, SZP, lubricin, MSF
MMRRC Submission 040910-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R3912 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 150449412-150466165 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150451868 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 278 (Y278C)
Ref Sequence ENSEMBL: ENSMUSP00000125551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000119161] [ENSMUST00000124484] [ENSMUST00000124973] [ENSMUST00000161320] [ENSMUST00000161611] [ENSMUST00000164600] [ENSMUST00000162367]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000006171
AA Change: Y278C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014
AA Change: Y278C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000111901
AA Change: Y820C
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014
AA Change: Y820C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111902
AA Change: Y867C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014
AA Change: Y867C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119161
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124484
SMART Domains Protein: ENSMUSP00000121991
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
low complexity region 50 64 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124973
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152967
Predicted Effect probably benign
Transcript: ENSMUST00000161320
SMART Domains Protein: ENSMUSP00000124801
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 3.83e-15 SMART
low complexity region 69 83 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
low complexity region 148 179 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161611
AA Change: Y1076C
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014
AA Change: Y1076C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000164600
AA Change: Y1076C
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014
AA Change: Y1076C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162367
AA Change: Y278C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014
AA Change: Y278C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Meta Mutation Damage Score 0.7893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Aging homozygous null mice develop a hopping gait, irregular endochondral growth plates, altered cartilage surface, camptodactyly, progressive synovial hyperplasia and, ultimately, joint failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G T 13: 63,156,706 E402* probably null Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Acot1 A G 12: 84,017,032 S305G probably damaging Het
Acot12 A G 13: 91,770,089 D167G probably benign Het
Adgra1 T C 7: 139,845,714 probably null Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Atp2c2 A G 8: 119,721,276 K103E probably damaging Het
Camkk1 A G 11: 73,033,816 D285G probably benign Het
Ccdc158 G C 5: 92,648,935 T514S possibly damaging Het
Cdhr5 T A 7: 141,273,857 D210V probably damaging Het
Cndp1 C T 18: 84,631,999 D190N probably benign Het
Eepd1 C T 9: 25,483,304 T288M probably damaging Het
Erbin G A 13: 103,886,338 probably benign Het
Erbin G T 13: 103,862,287 T197K probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Gm14326 T C 2: 177,945,865 K446R probably damaging Het
Gm5724 A G 6: 141,727,636 F392S probably damaging Het
Herc2 T C 7: 56,098,437 Y518H probably damaging Het
Id2 T A 12: 25,095,872 K47* probably null Het
Ilf2 A G 3: 90,487,060 N295S probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Mroh9 C T 1: 163,066,069 C179Y probably damaging Het
Mrps18b C T 17: 35,910,939 V165I probably benign Het
Myrip A G 9: 120,432,616 S432G probably benign Het
Nutm2 C T 13: 50,472,940 A377V possibly damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Pax7 C A 4: 139,780,898 W272L probably benign Het
Ppp1r12b C T 1: 134,887,318 E320K probably damaging Het
Pvr T C 7: 19,909,292 N339D probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Ryr2 A G 13: 11,772,427 I1020T probably damaging Het
Scn4a T A 11: 106,320,716 I1492F probably damaging Het
Sec16a C T 2: 26,414,387 G2304D probably damaging Het
Shisa7 T A 7: 4,830,240 R341* probably null Het
Slc19a3 T A 1: 83,022,703 M198L probably benign Het
Slc26a8 T A 17: 28,644,779 N669Y possibly damaging Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Susd4 A T 1: 182,887,466 Y284F probably damaging Het
Tas1r1 A T 4: 152,031,924 Y418N probably damaging Het
Tdrd12 A G 7: 35,487,713 I584T probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Vmn1r39 C T 6: 66,805,141 M27I probably benign Het
Vmn2r59 T C 7: 42,046,320 T223A probably benign Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Wnt3a A C 11: 59,250,002 D229E possibly damaging Het
Other mutations in Prg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Prg4 APN 1 150451920 missense probably damaging 0.99
IGL02033:Prg4 APN 1 150455868 intron probably benign
IGL02154:Prg4 APN 1 150454862 intron probably benign
IGL03111:Prg4 APN 1 150451902 missense probably benign 0.06
IGL03177:Prg4 APN 1 150455603 intron probably benign
IGL03260:Prg4 APN 1 150455627 intron probably benign
IGL03281:Prg4 APN 1 150450088 splice site probably benign
R0046:Prg4 UTSW 1 150456086 missense possibly damaging 0.53
R0046:Prg4 UTSW 1 150456086 missense possibly damaging 0.53
R0196:Prg4 UTSW 1 150454492 intron probably benign
R0233:Prg4 UTSW 1 150453547 splice site probably benign
R0255:Prg4 UTSW 1 150455807 intron probably benign
R0616:Prg4 UTSW 1 150460711 missense probably damaging 1.00
R1016:Prg4 UTSW 1 150454691 intron probably benign
R1826:Prg4 UTSW 1 150452009 missense probably benign 0.09
R1862:Prg4 UTSW 1 150460669 missense probably damaging 0.99
R1863:Prg4 UTSW 1 150460669 missense probably damaging 0.99
R1922:Prg4 UTSW 1 150449999 nonsense probably null
R1940:Prg4 UTSW 1 150456023 missense possibly damaging 0.53
R3765:Prg4 UTSW 1 150451371 missense probably damaging 0.97
R3855:Prg4 UTSW 1 150452000 missense probably damaging 1.00
R3894:Prg4 UTSW 1 150454759 intron probably benign
R3895:Prg4 UTSW 1 150454759 intron probably benign
R3935:Prg4 UTSW 1 150458157 missense possibly damaging 0.68
R4050:Prg4 UTSW 1 150454759 intron probably benign
R4475:Prg4 UTSW 1 150454859 intron probably benign
R4794:Prg4 UTSW 1 150454546 intron probably benign
R4910:Prg4 UTSW 1 150455823 intron probably benign
R4911:Prg4 UTSW 1 150455823 intron probably benign
R4993:Prg4 UTSW 1 150460681 missense probably damaging 1.00
R5378:Prg4 UTSW 1 150455226 intron probably benign
R5381:Prg4 UTSW 1 150454453 intron probably benign
R5452:Prg4 UTSW 1 150455768 intron probably benign
R5870:Prg4 UTSW 1 150455549 nonsense probably null
R5888:Prg4 UTSW 1 150452350 missense probably damaging 1.00
R5929:Prg4 UTSW 1 150454129 missense probably benign 0.01
R6058:Prg4 UTSW 1 150451446 missense probably damaging 0.99
R6059:Prg4 UTSW 1 150449997 missense possibly damaging 0.67
R6232:Prg4 UTSW 1 150455816 intron probably benign
R6272:Prg4 UTSW 1 150454766 intron probably benign
R6459:Prg4 UTSW 1 150454301 intron probably benign
R6659:Prg4 UTSW 1 150460681 missense probably damaging 1.00
R6663:Prg4 UTSW 1 150455101 intron probably benign
R6882:Prg4 UTSW 1 150453495 missense probably damaging 1.00
R6970:Prg4 UTSW 1 150455906 intron probably benign
R7078:Prg4 UTSW 1 150458263 missense possibly damaging 0.91
R7102:Prg4 UTSW 1 150452254 missense probably damaging 1.00
R7264:Prg4 UTSW 1 150454067 missense not run
R7487:Prg4 UTSW 1 150455905 missense unknown
R7531:Prg4 UTSW 1 150455035 missense unknown
R7651:Prg4 UTSW 1 150454945 missense unknown
R7701:Prg4 UTSW 1 150457542 missense possibly damaging 0.53
R8072:Prg4 UTSW 1 150456023 missense possibly damaging 0.53
R8168:Prg4 UTSW 1 150455850 missense unknown
R8248:Prg4 UTSW 1 150455126 missense unknown
R8436:Prg4 UTSW 1 150455567 missense unknown
R8460:Prg4 UTSW 1 150455941 missense possibly damaging 0.83
R8514:Prg4 UTSW 1 150454645 missense unknown
R8904:Prg4 UTSW 1 150456059 missense possibly damaging 0.83
R9072:Prg4 UTSW 1 150455537 missense unknown
R9073:Prg4 UTSW 1 150455537 missense unknown
R9274:Prg4 UTSW 1 150456173 missense possibly damaging 0.53
R9337:Prg4 UTSW 1 150451365 missense probably damaging 1.00
R9488:Prg4 UTSW 1 150451273 missense probably benign
R9613:Prg4 UTSW 1 150455909 missense unknown
R9670:Prg4 UTSW 1 150450867 missense probably benign 0.01
X0024:Prg4 UTSW 1 150454492 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTCCAGTTGTTTGATGGTTCAC -3'
(R):5'- GGATGAATTCCTGAAACATGCCTAC -3'

Sequencing Primer
(F):5'- TGATGGTTCACATTTCAGGAAATC -3'
(R):5'- TGCCTACAAAACCTTTGACATC -3'
Posted On 2015-04-17