Incidental Mutation 'R3912:Trim30a'
ID309456
Institutional Source Beutler Lab
Gene Symbol Trim30a
Ensembl Gene ENSMUSG00000030921
Gene Nametripartite motif-containing 30A
SynonymsRpt-1, Rpt1, Trim30
MMRRC Submission 040910-MU
Accession Numbers

Ncbi RefSeq: NM_009099.2; MGI:98178

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3912 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104409025-104465193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104411141 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 476 (V476A)
Ref Sequence ENSEMBL: ENSMUSP00000076189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076922]
PDB Structure
Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000076922
AA Change: V476A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076189
Gene: ENSMUSG00000030921
AA Change: V476A

DomainStartEndE-ValueType
RING 15 58 2.88e-10 SMART
BBOX 91 132 3.52e-14 SMART
coiled coil region 173 241 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
Pfam:SPRY 349 493 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211270
Meta Mutation Damage Score 0.4097 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygous null mice show increased CD4/CD8 ratio with age, an abnormal CD4+ T cell response upon TCR activation, and reduced effector function of CD4+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G T 13: 63,156,706 E402* probably null Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Acot1 A G 12: 84,017,032 S305G probably damaging Het
Acot12 A G 13: 91,770,089 D167G probably benign Het
Adgra1 T C 7: 139,845,714 probably null Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Atp2c2 A G 8: 119,721,276 K103E probably damaging Het
Camkk1 A G 11: 73,033,816 D285G probably benign Het
Ccdc158 G C 5: 92,648,935 T514S possibly damaging Het
Cdhr5 T A 7: 141,273,857 D210V probably damaging Het
Cndp1 C T 18: 84,631,999 D190N probably benign Het
Eepd1 C T 9: 25,483,304 T288M probably damaging Het
Erbin G A 13: 103,886,338 probably benign Het
Erbin G T 13: 103,862,287 T197K probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Gm14326 T C 2: 177,945,865 K446R probably damaging Het
Gm5724 A G 6: 141,727,636 F392S probably damaging Het
Herc2 T C 7: 56,098,437 Y518H probably damaging Het
Id2 T A 12: 25,095,872 K47* probably null Het
Ilf2 A G 3: 90,487,060 N295S probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Mroh9 C T 1: 163,066,069 C179Y probably damaging Het
Mrps18b C T 17: 35,910,939 V165I probably benign Het
Myrip A G 9: 120,432,616 S432G probably benign Het
Nutm2 C T 13: 50,472,940 A377V possibly damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Pax7 C A 4: 139,780,898 W272L probably benign Het
Ppp1r12b C T 1: 134,887,318 E320K probably damaging Het
Prg4 T C 1: 150,451,868 Y278C probably damaging Het
Pvr T C 7: 19,909,292 N339D probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Ryr2 A G 13: 11,772,427 I1020T probably damaging Het
Scn4a T A 11: 106,320,716 I1492F probably damaging Het
Sec16a C T 2: 26,414,387 G2304D probably damaging Het
Shisa7 T A 7: 4,830,240 R341* probably null Het
Slc19a3 T A 1: 83,022,703 M198L probably benign Het
Slc26a8 T A 17: 28,644,779 N669Y possibly damaging Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Susd4 A T 1: 182,887,466 Y284F probably damaging Het
Tas1r1 A T 4: 152,031,924 Y418N probably damaging Het
Tdrd12 A G 7: 35,487,713 I584T probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Vmn1r39 C T 6: 66,805,141 M27I probably benign Het
Vmn2r59 T C 7: 42,046,320 T223A probably benign Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Wnt3a A C 11: 59,250,002 D229E possibly damaging Het
Other mutations in Trim30a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02677:Trim30a APN 7 104435913 missense probably damaging 1.00
IGL02944:Trim30a APN 7 104435777 missense probably benign 0.19
IGL03135:Trim30a APN 7 104411141 missense probably damaging 0.98
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0682:Trim30a UTSW 7 104429182 missense probably damaging 1.00
R1773:Trim30a UTSW 7 104435901 missense probably damaging 1.00
R1862:Trim30a UTSW 7 104411198 missense probably damaging 0.99
R1872:Trim30a UTSW 7 104429210 missense probably benign 0.01
R1986:Trim30a UTSW 7 104411465 missense probably damaging 1.00
R1991:Trim30a UTSW 7 104430230 splice site probably benign
R2259:Trim30a UTSW 7 104411504 missense probably damaging 1.00
R2571:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
R3719:Trim30a UTSW 7 104411163 missense probably benign 0.00
R3880:Trim30a UTSW 7 104411189 missense probably benign
R3910:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R3911:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R4343:Trim30a UTSW 7 104435592 missense probably benign 0.00
R4572:Trim30a UTSW 7 104411188 nonsense probably null
R4587:Trim30a UTSW 7 104435644 nonsense probably null
R4997:Trim30a UTSW 7 104411620 missense probably benign 0.21
R5051:Trim30a UTSW 7 104411706 intron probably benign
R5414:Trim30a UTSW 7 104411141 missense probably damaging 1.00
R5613:Trim30a UTSW 7 104430182 missense probably damaging 1.00
R5930:Trim30a UTSW 7 104421450 missense possibly damaging 0.95
R6262:Trim30a UTSW 7 104411534 missense probably benign 0.00
R7133:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
R7222:Trim30a UTSW 7 104421432 splice site probably null
R7739:Trim30a UTSW 7 104430179 missense possibly damaging 0.50
R7797:Trim30a UTSW 7 104411200 missense possibly damaging 0.86
R7803:Trim30a UTSW 7 104411397 nonsense probably null
R7836:Trim30a UTSW 7 104435595 missense probably benign 0.06
R7908:Trim30a UTSW 7 104421449 missense probably benign 0.01
R7919:Trim30a UTSW 7 104435595 missense probably benign 0.06
R7989:Trim30a UTSW 7 104421449 missense probably benign 0.01
X0012:Trim30a UTSW 7 104430203 nonsense probably null
Z1088:Trim30a UTSW 7 104435654 missense probably damaging 1.00
Z1177:Trim30a UTSW 7 104411463 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGCATAAGATACACCAGACATG -3'
(R):5'- AGCCTAAATGTGGCTACTGG -3'

Sequencing Primer
(F):5'- CAGACATGGGGGCACTG -3'
(R):5'- GAATCCGTCTGTATACAAGGCCTTTG -3'
Posted On2015-04-17