Incidental Mutation 'R3912:Myrip'
ID309468
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Namemyosin VIIA and Rab interacting protein
SynonymsA230081N12Rik, Slac2-c
MMRRC Submission 040910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3912 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120301513-120474841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120432616 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 432 (S432G)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
Predicted Effect probably benign
Transcript: ENSMUST00000048121
AA Change: S432G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: S432G

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129168
Predicted Effect unknown
Transcript: ENSMUST00000214784
AA Change: S427G
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G T 13: 63,156,706 E402* probably null Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Acot1 A G 12: 84,017,032 S305G probably damaging Het
Acot12 A G 13: 91,770,089 D167G probably benign Het
Adgra1 T C 7: 139,845,714 probably null Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Atp2c2 A G 8: 119,721,276 K103E probably damaging Het
Camkk1 A G 11: 73,033,816 D285G probably benign Het
Ccdc158 G C 5: 92,648,935 T514S possibly damaging Het
Cdhr5 T A 7: 141,273,857 D210V probably damaging Het
Cndp1 C T 18: 84,631,999 D190N probably benign Het
Eepd1 C T 9: 25,483,304 T288M probably damaging Het
Erbin G T 13: 103,862,287 T197K probably benign Het
Erbin G A 13: 103,886,338 probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gbp3 C T 3: 142,566,338 probably benign Het
Gm14326 T C 2: 177,945,865 K446R probably damaging Het
Gm5724 A G 6: 141,727,636 F392S probably damaging Het
Herc2 T C 7: 56,098,437 Y518H probably damaging Het
Id2 T A 12: 25,095,872 K47* probably null Het
Ilf2 A G 3: 90,487,060 N295S probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Mroh9 C T 1: 163,066,069 C179Y probably damaging Het
Mrps18b C T 17: 35,910,939 V165I probably benign Het
Nutm2 C T 13: 50,472,940 A377V possibly damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Pax7 C A 4: 139,780,898 W272L probably benign Het
Ppp1r12b C T 1: 134,887,318 E320K probably damaging Het
Prg4 T C 1: 150,451,868 Y278C probably damaging Het
Pvr T C 7: 19,909,292 N339D probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Ryr2 A G 13: 11,772,427 I1020T probably damaging Het
Scn4a T A 11: 106,320,716 I1492F probably damaging Het
Sec16a C T 2: 26,414,387 G2304D probably damaging Het
Shisa7 T A 7: 4,830,240 R341* probably null Het
Slc19a3 T A 1: 83,022,703 M198L probably benign Het
Slc26a8 T A 17: 28,644,779 N669Y possibly damaging Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Susd4 A T 1: 182,887,466 Y284F probably damaging Het
Tas1r1 A T 4: 152,031,924 Y418N probably damaging Het
Tdrd12 A G 7: 35,487,713 I584T probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Vmn1r39 C T 6: 66,805,141 M27I probably benign Het
Vmn2r59 T C 7: 42,046,320 T223A probably benign Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Wnt3a A C 11: 59,250,002 D229E possibly damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120388264 missense probably damaging 1.00
IGL02108:Myrip APN 9 120467565 critical splice donor site probably null
IGL02406:Myrip APN 9 120467532 missense probably benign
IGL02876:Myrip APN 9 120432674 missense probably damaging 1.00
IGL03109:Myrip APN 9 120453724 splice site probably null
IGL03258:Myrip APN 9 120441352 missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120467517 missense probably damaging 0.98
R0485:Myrip UTSW 9 120441377 missense probably benign 0.01
R0633:Myrip UTSW 9 120388236 missense probably damaging 1.00
R1489:Myrip UTSW 9 120432529 missense probably damaging 1.00
R1539:Myrip UTSW 9 120424623 missense probably benign 0.00
R1708:Myrip UTSW 9 120464774 missense possibly damaging 0.65
R1817:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1818:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1878:Myrip UTSW 9 120424655 missense probably damaging 0.99
R2484:Myrip UTSW 9 120424619 missense probably benign 0.00
R3237:Myrip UTSW 9 120441407 missense possibly damaging 0.91
R3890:Myrip UTSW 9 120422258 missense probably damaging 1.00
R3919:Myrip UTSW 9 120432629 missense probably damaging 1.00
R4125:Myrip UTSW 9 120464698 nonsense probably null
R4126:Myrip UTSW 9 120464698 nonsense probably null
R4128:Myrip UTSW 9 120464698 nonsense probably null
R4435:Myrip UTSW 9 120335614 start gained probably benign
R4599:Myrip UTSW 9 120464784 missense probably damaging 0.97
R5014:Myrip UTSW 9 120422468 missense probably damaging 1.00
R5665:Myrip UTSW 9 120461433 missense probably damaging 1.00
R5814:Myrip UTSW 9 120424668 missense probably benign 0.06
R5849:Myrip UTSW 9 120453693 missense probably damaging 0.99
R5986:Myrip UTSW 9 120461421 missense probably damaging 1.00
R6706:Myrip UTSW 9 120388293 missense possibly damaging 0.93
R7019:Myrip UTSW 9 120422507 missense probably damaging 1.00
R7291:Myrip UTSW 9 120417141 missense probably damaging 0.97
R8204:Myrip UTSW 9 120432979 critical splice donor site probably null
Z1177:Myrip UTSW 9 120432778 missense probably benign
Z1177:Myrip UTSW 9 120441481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGAAGAGTGGGACCTTTC -3'
(R):5'- ACTGTCGGAAGTCTCTCCAC -3'

Sequencing Primer
(F):5'- AAGAGTGGGACCTTTCAGGCC -3'
(R):5'- GGTTGAAATTGACGTCCAGTTCTCC -3'
Posted On2015-04-17