Incidental Mutation 'R3913:Olfm1'
ID309490
Institutional Source Beutler Lab
Gene Symbol Olfm1
Ensembl Gene ENSMUSG00000026833
Gene Nameolfactomedin 1
SynonymsNoelin 1, Pancortin 1-4, Noelin 2
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28192992-28230736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28208174 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 83 (T83A)
Ref Sequence ENSEMBL: ENSMUSP00000028177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028177] [ENSMUST00000100244] [ENSMUST00000102879] [ENSMUST00000113920]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028177
AA Change: T83A

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028177
Gene: ENSMUSG00000026833
AA Change: T83A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 54 153 1.5e-50 PFAM
Blast:OLF 170 215 1e-5 BLAST
OLF 228 478 5.43e-170 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100244
AA Change: T55A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097815
Gene: ENSMUSG00000026833
AA Change: T55A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Noelin-1 25 125 2.6e-53 PFAM
Blast:OLF 142 187 1e-5 BLAST
OLF 200 450 5.43e-170 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102879
AA Change: T83A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099943
Gene: ENSMUSG00000026833
AA Change: T83A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 53 153 4.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113920
AA Change: T40A

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109553
Gene: ENSMUSG00000026833
AA Change: T40A

DomainStartEndE-ValueType
Pfam:Noelin-1 10 110 7.4e-53 PFAM
Blast:OLF 127 172 1e-5 BLAST
OLF 185 435 5.43e-170 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152415
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product shares extensive sequence similarity with the rat neuronal olfactomedin-related ER localized protein. While the exact function of the encoded protein is not known, its abundant expression in brain suggests that it may have an essential role in nerve tissue. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display decreased cerebral infarction size and reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Olfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Olfm1 APN 2 28214703 missense probably damaging 1.00
IGL01326:Olfm1 APN 2 28229552 missense probably damaging 1.00
IGL01358:Olfm1 APN 2 28229495 missense probably damaging 1.00
IGL02076:Olfm1 APN 2 28222625 missense probably damaging 0.99
IGL02337:Olfm1 APN 2 28229685 missense probably damaging 1.00
IGL02693:Olfm1 APN 2 28212650 missense probably damaging 1.00
IGL02825:Olfm1 APN 2 28229078 missense probably damaging 1.00
IGL02974:Olfm1 APN 2 28229689 missense probably damaging 1.00
R0266:Olfm1 UTSW 2 28229607 missense probably damaging 1.00
R0348:Olfm1 UTSW 2 28212542 missense probably benign 0.26
R0411:Olfm1 UTSW 2 28208211 missense possibly damaging 0.51
R0542:Olfm1 UTSW 2 28214628 missense possibly damaging 0.85
R1252:Olfm1 UTSW 2 28229435 missense probably benign 0.01
R1649:Olfm1 UTSW 2 28229267 missense possibly damaging 0.71
R1696:Olfm1 UTSW 2 28208116 nonsense probably null
R1931:Olfm1 UTSW 2 28222662 splice site probably null
R1986:Olfm1 UTSW 2 28214706 missense probably benign 0.13
R3749:Olfm1 UTSW 2 28208088 missense probably damaging 0.96
R4927:Olfm1 UTSW 2 28214786 missense probably benign 0.18
R4940:Olfm1 UTSW 2 28222590 missense possibly damaging 0.51
R7033:Olfm1 UTSW 2 28229336 missense probably damaging 1.00
R7059:Olfm1 UTSW 2 28222616 missense probably damaging 1.00
R8046:Olfm1 UTSW 2 28229123 missense possibly damaging 0.71
X0018:Olfm1 UTSW 2 28229369 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GCATTTTAAGGCACTGTTCCTC -3'
(R):5'- GGTCATCTGCCCATTCATTCAG -3'

Sequencing Primer
(F):5'- TTTGAGACCTCAGCACCTGG -3'
(R):5'- TCAGTCACAAATGTTTAGAGCGTGG -3'
Posted On2015-04-17