Incidental Mutation 'R3913:Kcnab2'
ID309498
Institutional Source Beutler Lab
Gene Symbol Kcnab2
Ensembl Gene ENSMUSG00000028931
Gene Namepotassium voltage-gated channel, shaker-related subfamily, beta member 2
SynonymsKcnb3, I2rf5, F5, I2rf5
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152390742-152477871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152395232 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 187 (V187A)
Ref Sequence ENSEMBL: ENSMUSP00000124156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030768] [ENSMUST00000105648] [ENSMUST00000159186] [ENSMUST00000159840] [ENSMUST00000160884]
Predicted Effect probably damaging
Transcript: ENSMUST00000030768
AA Change: V187A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030768
Gene: ENSMUSG00000028931
AA Change: V187A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 37 342 1.6e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105648
AA Change: V201A

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101273
Gene: ENSMUSG00000028931
AA Change: V201A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 356 7e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159186
AA Change: V216A

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124588
Gene: ENSMUSG00000028931
AA Change: V216A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 371 4.3e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159840
AA Change: V187A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124156
Gene: ENSMUSG00000028931
AA Change: V187A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 37 342 1.6e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159844
Predicted Effect possibly damaging
Transcript: ENSMUST00000160884
AA Change: V201A

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125058
Gene: ENSMUSG00000028931
AA Change: V201A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 356 7e-77 PFAM
Meta Mutation Damage Score 0.5133 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice show strain-specific changes in survival, body weight, thermoregulation and cold-swim induced tremors, impaired associative learning and memory, sporadic seizures and amygala hyperexcitability. Mice homozygous for a knock-in mutationshow no deficits in associative learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Kcnab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Kcnab2 APN 4 152393797 missense possibly damaging 0.94
IGL02201:Kcnab2 APN 4 152401918 unclassified probably benign
IGL02449:Kcnab2 APN 4 152411984 critical splice donor site probably null
IGL02957:Kcnab2 APN 4 152435869 missense possibly damaging 0.62
R0415:Kcnab2 UTSW 4 152395136 missense probably benign 0.39
R0485:Kcnab2 UTSW 4 152394982 missense probably benign
R1759:Kcnab2 UTSW 4 152393052 missense probably damaging 0.99
R1933:Kcnab2 UTSW 4 152435866 missense possibly damaging 0.66
R3037:Kcnab2 UTSW 4 152393756 missense possibly damaging 0.94
R4178:Kcnab2 UTSW 4 152404601 missense probably null 1.00
R4863:Kcnab2 UTSW 4 152401946 missense probably damaging 1.00
R4919:Kcnab2 UTSW 4 152401940 missense probably damaging 1.00
R5996:Kcnab2 UTSW 4 152434830 splice site probably null
R6519:Kcnab2 UTSW 4 152411993 missense probably damaging 0.96
R7753:Kcnab2 UTSW 4 152396761 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CATACTTCCCTGAGACGATGC -3'
(R):5'- ATTTGCCTCGGCCCTTTAAG -3'

Sequencing Primer
(F):5'- TCATGGCACCTACTCCTGAGAG -3'
(R):5'- TAAGTCTTAGGATTCCAAAGCCC -3'
Posted On2015-04-17