Incidental Mutation 'R3913:Sema4b'
ID309500
Institutional Source Beutler Lab
Gene Symbol Sema4b
Ensembl Gene ENSMUSG00000030539
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
SynonymsSemac, SemC
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80186841-80226527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80220474 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 467 (S467G)
Ref Sequence ENSEMBL: ENSMUSP00000145622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032754] [ENSMUST00000205822]
Predicted Effect probably benign
Transcript: ENSMUST00000032754
AA Change: S467G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032754
Gene: ENSMUSG00000030539
AA Change: S467G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 582 4.7e-9 SMART
low complexity region 626 639 N/A INTRINSIC
transmembrane domain 701 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107383
SMART Domains Protein: ENSMUSP00000103006
Gene: ENSMUSG00000030539

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 550 2.68e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205822
AA Change: S467G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal cerebellar morphology. Mice homozygous for a knock-out allele exhibit enhanced memory response by way of increased IgE and IgG1 serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Sema4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Sema4b APN 7 80215696 missense probably damaging 1.00
IGL02584:Sema4b APN 7 80224988 missense probably benign
IGL02657:Sema4b APN 7 80217041 missense probably damaging 1.00
false_flag UTSW 7 80198654 start codon destroyed probably null
R0114:Sema4b UTSW 7 80219078 splice site probably benign
R0480:Sema4b UTSW 7 80220206 missense probably damaging 1.00
R1184:Sema4b UTSW 7 80224640 missense probably benign 0.27
R1545:Sema4b UTSW 7 80219023 missense probably benign 0.02
R1687:Sema4b UTSW 7 80219262 missense probably damaging 1.00
R1880:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R1881:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R2180:Sema4b UTSW 7 80212835 missense probably benign 0.28
R2352:Sema4b UTSW 7 80220879 missense probably damaging 0.99
R2424:Sema4b UTSW 7 80219275 missense probably damaging 1.00
R4353:Sema4b UTSW 7 80215651 missense probably damaging 1.00
R4757:Sema4b UTSW 7 80216829 missense probably damaging 1.00
R4921:Sema4b UTSW 7 80198756 missense possibly damaging 0.77
R5004:Sema4b UTSW 7 80216345 missense probably benign 0.13
R5399:Sema4b UTSW 7 80224886 missense probably benign
R5599:Sema4b UTSW 7 80213291 missense probably benign 0.40
R5820:Sema4b UTSW 7 80224958 missense probably damaging 0.99
R5840:Sema4b UTSW 7 80218949 missense probably damaging 1.00
R5901:Sema4b UTSW 7 80224967 missense possibly damaging 0.49
R6600:Sema4b UTSW 7 80212928 missense probably benign 0.42
R6749:Sema4b UTSW 7 80220201 missense possibly damaging 0.56
R6992:Sema4b UTSW 7 80220152 missense probably damaging 0.97
R7175:Sema4b UTSW 7 80198654 start codon destroyed probably null
R7660:Sema4b UTSW 7 80220247 missense probably benign 0.01
R8345:Sema4b UTSW 7 80220819 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACTTATGATGTCCTATTTCTGGGC -3'
(R):5'- CATGCTCACTAGTCATCCCAGG -3'

Sequencing Primer
(F):5'- CACTGGTGAGTGTCTGCAGC -3'
(R):5'- CCTTTTTATGGTCAGAAGCCAG -3'
Posted On2015-04-17