Incidental Mutation 'R3913:Dcaf15'
List |< first << previous [record 8 of 54] next >> last >|
ID309506
Institutional Source Beutler Lab
Gene Symbol Dcaf15
Ensembl Gene ENSMUSG00000037103
Gene NameDDB1 and CUL4 associated factor 15
Synonyms
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R3913 (G1)
Quality Score172
Status Validated
Chromosome8
Chromosomal Location84097072-84104768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84099165 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 271 (Y271C)
Ref Sequence ENSEMBL: ENSMUSP00000147690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005600] [ENSMUST00000041367] [ENSMUST00000210279] [ENSMUST00000210625] [ENSMUST00000211046]
Predicted Effect probably benign
Transcript: ENSMUST00000005600
SMART Domains Protein: ENSMUSP00000005600
Gene: ENSMUSG00000031706

DomainStartEndE-ValueType
low complexity region 11 47 N/A INTRINSIC
low complexity region 53 67 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
Pfam:RFX1_trans_act 106 176 9.6e-9 PFAM
Pfam:RFX1_trans_act 211 366 1.8e-59 PFAM
Pfam:RFX_DNA_binding 420 498 2.5e-35 PFAM
Blast:HisKA 705 768 3e-28 BLAST
low complexity region 908 920 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041367
AA Change: Y271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038568
Gene: ENSMUSG00000037103
AA Change: Y271C

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:DCAF15_WD40 48 259 1.1e-84 PFAM
low complexity region 275 294 N/A INTRINSIC
low complexity region 343 359 N/A INTRINSIC
low complexity region 374 384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210279
AA Change: Y271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210625
Predicted Effect probably benign
Transcript: ENSMUST00000211046
Meta Mutation Damage Score 0.6035 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Dcaf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Dcaf15 APN 8 84098397 missense probably damaging 0.98
IGL01455:Dcaf15 APN 8 84098590 missense probably benign
IGL01656:Dcaf15 APN 8 84097988 missense probably benign 0.01
IGL02437:Dcaf15 APN 8 84101816 missense probably damaging 1.00
IGL02718:Dcaf15 APN 8 84098376 missense possibly damaging 0.52
R2072:Dcaf15 UTSW 8 84101741 missense probably damaging 1.00
R2090:Dcaf15 UTSW 8 84097771 nonsense probably null
R4582:Dcaf15 UTSW 8 84097969 missense probably damaging 1.00
R4657:Dcaf15 UTSW 8 84102838 missense probably damaging 0.99
R4714:Dcaf15 UTSW 8 84102216 missense probably benign 0.21
R4734:Dcaf15 UTSW 8 84097728 missense probably benign 0.00
R5898:Dcaf15 UTSW 8 84098452 missense probably damaging 1.00
R6167:Dcaf15 UTSW 8 84097997 missense possibly damaging 0.78
R6261:Dcaf15 UTSW 8 84099105 missense probably benign
R6408:Dcaf15 UTSW 8 84104726 missense probably benign 0.00
R7248:Dcaf15 UTSW 8 84102765 missense possibly damaging 0.89
R7498:Dcaf15 UTSW 8 84101763 missense probably damaging 1.00
Z1088:Dcaf15 UTSW 8 84102781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTCCTCCAAGGGACTACC -3'
(R):5'- CTCGTCTTTGTTCAGACTATATGTG -3'

Sequencing Primer
(F):5'- CTCTTTAGCCCTGCGGAAGATG -3'
(R):5'- CAGACTATATGTGCTTTCTGAACTC -3'
Posted On2015-04-17